ID: 998206063

View in Genome Browser
Species Human (GRCh38)
Location 5:140157602-140157624
Sequence GTCCGCTCCGTGACAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998206050_998206063 28 Left 998206050 5:140157551-140157573 CCTGCCACTCTCATCTCCGGAGT No data
Right 998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG No data
998206052_998206063 24 Left 998206052 5:140157555-140157577 CCACTCTCATCTCCGGAGTGGCA No data
Right 998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG No data
998206060_998206063 -3 Left 998206060 5:140157582-140157604 CCGGGTCTGATTGGACGGGAGTC No data
Right 998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG No data
998206055_998206063 12 Left 998206055 5:140157567-140157589 CCGGAGTGGCATCACCCGGGTCT No data
Right 998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG No data
998206059_998206063 -2 Left 998206059 5:140157581-140157603 CCCGGGTCTGATTGGACGGGAGT No data
Right 998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998206063 Original CRISPR GTCCGCTCCGTGACAGTGGG CGG Intergenic
No off target data available for this crispr