ID: 998206770

View in Genome Browser
Species Human (GRCh38)
Location 5:140162908-140162930
Sequence GTTTGCAGTACTGGAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998206770_998206776 6 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206776 5:140162937-140162959 TCTGAGGATGTTAACCCCTTGGG No data
998206770_998206782 25 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206782 5:140162956-140162978 TGGGAGTAACCCTGGGCCCTTGG No data
998206770_998206777 17 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206777 5:140162948-140162970 TAACCCCTTGGGAGTAACCCTGG No data
998206770_998206783 28 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data
998206770_998206774 -10 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206774 5:140162921-140162943 TACTGCAAACTGGATGTCTGAGG No data
998206770_998206775 5 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206775 5:140162936-140162958 GTCTGAGGATGTTAACCCCTTGG No data
998206770_998206778 18 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206778 5:140162949-140162971 AACCCCTTGGGAGTAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998206770 Original CRISPR GTTTGCAGTACTGGAGTCCA GGG (reversed) Intergenic
No off target data available for this crispr