ID: 998206771

View in Genome Browser
Species Human (GRCh38)
Location 5:140162909-140162931
Sequence AGTTTGCAGTACTGGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998206771_998206782 24 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206782 5:140162956-140162978 TGGGAGTAACCCTGGGCCCTTGG No data
998206771_998206777 16 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206777 5:140162948-140162970 TAACCCCTTGGGAGTAACCCTGG No data
998206771_998206776 5 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206776 5:140162937-140162959 TCTGAGGATGTTAACCCCTTGGG No data
998206771_998206778 17 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206778 5:140162949-140162971 AACCCCTTGGGAGTAACCCTGGG No data
998206771_998206775 4 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206775 5:140162936-140162958 GTCTGAGGATGTTAACCCCTTGG No data
998206771_998206783 27 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998206771 Original CRISPR AGTTTGCAGTACTGGAGTCC AGG (reversed) Intergenic
No off target data available for this crispr