ID: 998206773

View in Genome Browser
Species Human (GRCh38)
Location 5:140162917-140162939
Sequence AGACATCCAGTTTGCAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998206773_998206784 23 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206784 5:140162963-140162985 AACCCTGGGCCCTTGGCGGCTGG No data
998206773_998206777 8 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206777 5:140162948-140162970 TAACCCCTTGGGAGTAACCCTGG No data
998206773_998206785 24 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206785 5:140162964-140162986 ACCCTGGGCCCTTGGCGGCTGGG No data
998206773_998206778 9 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206778 5:140162949-140162971 AACCCCTTGGGAGTAACCCTGGG No data
998206773_998206783 19 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data
998206773_998206782 16 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206782 5:140162956-140162978 TGGGAGTAACCCTGGGCCCTTGG No data
998206773_998206789 29 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206789 5:140162969-140162991 GGGCCCTTGGCGGCTGGGGTTGG No data
998206773_998206787 25 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206787 5:140162965-140162987 CCCTGGGCCCTTGGCGGCTGGGG No data
998206773_998206776 -3 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206776 5:140162937-140162959 TCTGAGGATGTTAACCCCTTGGG No data
998206773_998206775 -4 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206775 5:140162936-140162958 GTCTGAGGATGTTAACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998206773 Original CRISPR AGACATCCAGTTTGCAGTAC TGG (reversed) Intergenic
No off target data available for this crispr