ID: 998206783

View in Genome Browser
Species Human (GRCh38)
Location 5:140162959-140162981
Sequence GAGTAACCCTGGGCCCTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998206773_998206783 19 Left 998206773 5:140162917-140162939 CCAGTACTGCAAACTGGATGTCT No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data
998206771_998206783 27 Left 998206771 5:140162909-140162931 CCTGGACTCCAGTACTGCAAACT No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data
998206770_998206783 28 Left 998206770 5:140162908-140162930 CCCTGGACTCCAGTACTGCAAAC No data
Right 998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998206783 Original CRISPR GAGTAACCCTGGGCCCTTGG CGG Intergenic
No off target data available for this crispr