ID: 998209712

View in Genome Browser
Species Human (GRCh38)
Location 5:140185721-140185743
Sequence ACTTTAACACAGGAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998209712_998209718 12 Left 998209712 5:140185721-140185743 CCCTGGGGCTCCTGTGTTAAAGT 0: 1
1: 0
2: 0
3: 10
4: 143
Right 998209718 5:140185756-140185778 AGCAAGTTCTTCCTAGGAGAAGG No data
998209712_998209717 6 Left 998209712 5:140185721-140185743 CCCTGGGGCTCCTGTGTTAAAGT 0: 1
1: 0
2: 0
3: 10
4: 143
Right 998209717 5:140185750-140185772 ATCAGGAGCAAGTTCTTCCTAGG 0: 1
1: 0
2: 3
3: 19
4: 334
998209712_998209720 25 Left 998209712 5:140185721-140185743 CCCTGGGGCTCCTGTGTTAAAGT 0: 1
1: 0
2: 0
3: 10
4: 143
Right 998209720 5:140185769-140185791 TAGGAGAAGGCCTACAGTTCTGG 0: 1
1: 0
2: 2
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998209712 Original CRISPR ACTTTAACACAGGAGCCCCA GGG (reversed) Intronic
903677081 1:25071201-25071223 ACACTCACACAGGAGGCCCAGGG - Intergenic
904671742 1:32171165-32171187 TCTTTAACCCAGGAGCCCAGGGG + Exonic
904995291 1:34626762-34626784 ACATTCACACTGGAGCTCCAGGG + Intergenic
905334117 1:37232313-37232335 CCTATAATCCAGGAGCCCCAGGG - Intergenic
907438810 1:54465770-54465792 ACTTTCACACTGGAGACCCTGGG - Intergenic
908340457 1:63173321-63173343 ACTTCAACACAGGCCCCCTAAGG + Intergenic
913465175 1:119133137-119133159 CTTTTAACACATGAGTCCCAAGG - Intronic
913541644 1:119826794-119826816 ACTTGAAATCATGAGCCCCAAGG - Intergenic
914446123 1:147751962-147751984 ACTTGAGCCCAGGAGTCCCAGGG - Intergenic
919876861 1:201875615-201875637 AATTTAACATGGGAGCCTCATGG + Intronic
920840135 1:209547095-209547117 ATTTTAAGACAGGACCCCAAAGG - Intergenic
922776094 1:228214815-228214837 CCTTTACCACAGGATCCACAGGG - Exonic
923156647 1:231285161-231285183 ACTTTTGCACAGGAATCCCATGG + Intergenic
923234116 1:232015712-232015734 AATTTCACACAGGAGCTTCATGG - Intronic
1064695326 10:17959317-17959339 ACTCAAACAGAGGAGACCCAGGG - Intronic
1066338915 10:34509880-34509902 AGTTTAATACAGCAGCCACAAGG + Intronic
1067296246 10:44976681-44976703 ACTTCCACACAGGGGCCTCATGG - Exonic
1069430347 10:68329533-68329555 ACTTGAACCCAGGAGGACCAAGG + Intronic
1070108680 10:73461362-73461384 ACTTTAACCCAGGAGGCGGAGGG + Intronic
1070657906 10:78283765-78283787 ACTTTGACACAGGGGCCAGAGGG - Intergenic
1072903165 10:99427623-99427645 CATTTAACAGATGAGCCCCAGGG + Intronic
1075661405 10:124199534-124199556 ACCTGGAGACAGGAGCCCCAGGG - Intergenic
1076481733 10:130789252-130789274 ACTCTCCCACAGCAGCCCCAGGG + Intergenic
1077223469 11:1427425-1427447 ACGTTAACACGGGTGCCCCCAGG - Intronic
1079485046 11:20927048-20927070 ACTGTAACTCAGGAACCTCATGG - Intronic
1080387716 11:31819523-31819545 GCCTTAACACAGGATGCCCAGGG - Intronic
1084837253 11:71811848-71811870 AAGTTAACACAGGAGTCCCCAGG + Intergenic
1085014288 11:73162778-73162800 ACGTTGACAAAGGAGCCCCAGGG + Intergenic
1087562708 11:99811809-99811831 ACTTTAACACATGCTCCCTAAGG + Intronic
1089368219 11:117934066-117934088 TCTTAAACGCAGGGGCCCCAGGG + Intergenic
1091989112 12:4940297-4940319 ACTTTAAGACAGGAAACCAATGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1098823919 12:75269579-75269601 ACTTGAACCCAGGAGATCCAGGG - Intergenic
1101865436 12:108516488-108516510 ACTTGAACTCAGGAACCCCACGG - Intronic
1102388873 12:112533916-112533938 ACTTGAACCCAGGAGTCCCAGGG - Intergenic
1104290340 12:127460684-127460706 ACTTTAGCATTGGAGCCCCAAGG + Intergenic
1105880928 13:24606399-24606421 GCTTCAACACTGCAGCCCCAGGG + Intergenic
1106527326 13:30552948-30552970 GCTGTGACACAGGAGTCCCATGG + Intronic
1114412866 14:22517261-22517283 ACCTTGACAGAAGAGCCCCAGGG - Intergenic
1117061467 14:51967842-51967864 ACTTGAACAAAGGAGGGCCATGG - Exonic
1119081953 14:71703154-71703176 TTTTCAACACAGGAGCCTCAGGG + Intronic
1120708191 14:87766393-87766415 CATTCAACACAGGATCCCCAGGG + Intergenic
1125206928 15:37163816-37163838 ACTGTATCAGAGGAGCTCCATGG + Intergenic
1128216348 15:65936898-65936920 CCTTTCTCACAAGAGCCCCATGG - Intronic
1128934515 15:71733835-71733857 ACTTGAACCCAGGAGACACAGGG + Intronic
1129217069 15:74106629-74106651 ACGTCCACACAAGAGCCCCATGG + Intronic
1129407605 15:75329428-75329450 ACATCCACACAAGAGCCCCATGG - Intergenic
1129542809 15:76364707-76364729 ACTTCCACACTGAAGCCCCAGGG - Intronic
1129734221 15:77950932-77950954 ACATCCACACAAGAGCCCCATGG + Intergenic
1129841362 15:78745059-78745081 ACATCCACACAAGAGCCCCATGG - Intergenic
1131691687 15:94834142-94834164 ACATTTGCACATGAGCCCCAGGG - Intergenic
1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG + Intergenic
1133279703 16:4658218-4658240 ACTGTTACACAGGAACCCCCTGG - Intronic
1133775116 16:8889640-8889662 ACCTTCTCACAGGAGCCCAATGG + Intergenic
1134099898 16:11444711-11444733 ACTTTACCACCGTAGCCACAGGG - Intronic
1136390730 16:29962473-29962495 ACTTTAACACAGGAGGGGTAGGG - Intronic
1138163669 16:54779411-54779433 ATTTTAACACAGCAGGGCCAGGG + Intergenic
1138347071 16:56326606-56326628 ACATTCAGACAGGATCCCCATGG - Intronic
1138651811 16:58464973-58464995 ACTTCTCCAGAGGAGCCCCAAGG - Intronic
1138808516 16:60121155-60121177 ACTTTAACACAAGACACCTATGG + Intergenic
1144411041 17:15002035-15002057 ATTTTCTCACAGCAGCCCCATGG + Intergenic
1145002076 17:19312623-19312645 ACTGTAACAGAGGAGGCCAATGG - Intronic
1147155867 17:38544261-38544283 ACTTTAGCAGAGGCTCCCCAAGG - Intronic
1147869794 17:43579116-43579138 ACTTCAGCACAGGAGCTCCGAGG - Intronic
1149253380 17:54795987-54796009 ATTAAAACACTGGAGCCCCAGGG - Intergenic
1150422172 17:65047303-65047325 ACTTGAGCCCAGGAGTCCCAAGG + Intronic
1152797516 17:82315510-82315532 ATTTTAACACGAGACCCCCACGG + Intronic
1154328454 18:13409326-13409348 CATTTTACACAGGATCCCCAAGG - Intronic
1157440369 18:47707092-47707114 ACTTTCTCACAGCAGCCCCAAGG + Intergenic
1157611282 18:48957635-48957657 ACTTGAACCCAGGAGGCCGAGGG + Intergenic
1162713025 19:12610370-12610392 ACTTTAGAAAAGGAACCCCAAGG - Intronic
1163297012 19:16418943-16418965 ACTTTGTCACAGCAGCCCAATGG + Intronic
1165307918 19:35013529-35013551 CCTTTCCCACAGGACCCCCAAGG + Exonic
1167503420 19:49859660-49859682 GCTTCAACTCAGGAGCCCGAGGG - Intronic
925116430 2:1382359-1382381 TCTTCAACACAGAAACCCCAAGG + Intronic
925743312 2:7024672-7024694 ACATTAACTCATGAGCGCCATGG + Intronic
931141479 2:59463143-59463165 ACTTTTACACAGTATGCCCAGGG + Intergenic
932247364 2:70206898-70206920 ACTTTAACTCAGGAGGCTGAGGG - Intronic
932786222 2:74606240-74606262 ATTTTAAGACAGAAGCCACAGGG + Intronic
936791073 2:116152939-116152961 TTTTTCACACAGGAGCTCCAGGG + Intergenic
937385488 2:121428096-121428118 ATTTTAAAAGGGGAGCCCCAAGG + Intronic
939465758 2:142553864-142553886 ACTTTAACACAGGAAATTCAAGG - Intergenic
942438400 2:176005465-176005487 ACTTGAACCCAGGAGCCAGAGGG + Intergenic
946193603 2:218020666-218020688 CCTTTAACTCAGAACCCCCAGGG - Intergenic
948065308 2:235074293-235074315 ACTTTAACAAAGAAGCCTCCAGG - Intergenic
1172200788 20:33124709-33124731 ACTTCATCATAGAAGCCCCAGGG + Intergenic
1172330792 20:34074880-34074902 CCCTGAACAAAGGAGCCCCAAGG + Intronic
1174482697 20:50842498-50842520 ACTTGAACCCAGGAGGCCAAAGG - Intronic
1175056565 20:56204300-56204322 ACTTTAGGTCAGGATCCCCAGGG + Intergenic
1176703292 21:10085171-10085193 ACTTTAGCCCAGGAGCTCAAAGG - Intergenic
1179060031 21:37971343-37971365 AGTTTAACACCTTAGCCCCAAGG - Intronic
1181008741 22:20027879-20027901 ACTTGAACCCAGGAGCCGGAGGG - Intronic
1182020554 22:27077906-27077928 ACTTGAACACAGGACACCGAAGG - Intergenic
949512574 3:4779618-4779640 ACTTTATAACATGAGGCCCAAGG + Exonic
950286020 3:11745246-11745268 ACTTGAGCACAGGAGGCCTAGGG + Intergenic
952269658 3:31818547-31818569 CCTCTCACACAGGAGCCCAACGG + Intronic
954478857 3:50778376-50778398 ACTTGAACACAGGATATCCAAGG + Intronic
960004845 3:112771366-112771388 ACTTCAACACATGTGACCCAGGG - Intronic
960598978 3:119436252-119436274 ACTTAAACACAGGAGAAGCAGGG + Intronic
962241854 3:133756786-133756808 AGCTTAACACAGGAGAGCCATGG - Intronic
969778660 4:9379340-9379362 AAGTTAACACAGGAGTCCCCAGG + Intergenic
971074109 4:23128358-23128380 ACTTTAACATAGTATCACCATGG - Intergenic
979395820 4:120187949-120187971 ACTTTATTACAGCAGCCCTAAGG - Intergenic
981806936 4:148727712-148727734 ACTTGAACCCAGGAGGCCGAGGG - Intergenic
986145091 5:5070652-5070674 ATTTTAAACCAGGAGCCCAAGGG + Intergenic
986582746 5:9282162-9282184 CCTTTAACACAAGAGCATCATGG + Intronic
990699597 5:58460499-58460521 ACCTTGACACAGGAGGCCCCGGG - Intergenic
991546447 5:67787086-67787108 AATATACAACAGGAGCCCCAAGG - Intergenic
995831110 5:116357285-116357307 AATTTAACCCAGGTGCTCCATGG + Intronic
997471294 5:134118495-134118517 TCTCTAACACAGTAGCCACATGG - Intronic
998077254 5:139246716-139246738 GCTTTAACCCAGCAGCCCCTAGG - Intronic
998209712 5:140185721-140185743 ACTTTAACACAGGAGCCCCAGGG - Intronic
999153325 5:149441278-149441300 ACTTTATCACAATATCCCCAGGG - Intergenic
999772329 5:154785077-154785099 AATTTATCACAGGTCCCCCAGGG - Intronic
1006861823 6:37176752-37176774 GCTTGAACCCAGGAGCTCCAAGG + Intergenic
1010076861 6:71808729-71808751 ACTCTTACACAGGAGCCCTTTGG - Intergenic
1013975053 6:116067322-116067344 ACTTTATTACAGCAGCCCAAAGG + Intergenic
1014188125 6:118458744-118458766 ACTTTAACTGGGGAGACCCATGG + Intergenic
1015275864 6:131382970-131382992 ATTTTAACACTGGAGGCCCACGG - Intergenic
1019750164 7:2724231-2724253 ACTTTAACAGACGAGCTACACGG + Intronic
1021006031 7:15396211-15396233 ACTTCAAGAAAGAAGCCCCACGG + Intronic
1021051166 7:15987146-15987168 ACTATATCAGGGGAGCCCCAAGG - Intergenic
1023190219 7:37572277-37572299 ACATTAACACAGGATCCACAGGG + Intergenic
1029272619 7:99385932-99385954 ACTTTAACCCAGGAGGCCCCTGG - Intronic
1029692982 7:102194939-102194961 ACTTGAACCCAGGAGCCAGAGGG + Intronic
1036276106 8:7353312-7353334 AAGTTAACACAGGAGTCCCCAGG + Intergenic
1036345241 8:7957034-7957056 AAGTTAACACAGGAGTCCCCAGG - Intergenic
1036840574 8:12117802-12117824 AAGTTAACACAGGAGTCCCCAGG - Intergenic
1036862373 8:12364046-12364068 AAGTTAACACAGGAGTCCCCAGG - Intergenic
1037335025 8:17783617-17783639 AGTTGAACACAGTAGCCACAGGG - Intronic
1038713977 8:29975034-29975056 ACTTGAGCTCAGGAGTCCCAGGG + Intergenic
1039383390 8:37107068-37107090 CTTCTTACACAGGAGCCCCATGG + Intergenic
1047832917 8:128655838-128655860 CCTTTAACAGAGCAGACCCAAGG - Intergenic
1048246761 8:132811828-132811850 ATTTTAAAACAGGAGAACCAAGG - Intronic
1048579973 8:135722758-135722780 AGTGTGACACAGGAGACCCATGG + Intergenic
1052168381 9:25362776-25362798 ACTTTACCACAGTAGCATCAGGG - Intergenic
1053640556 9:40072186-40072208 ACTTTAGCCCAGGAGCTCAAAGG - Intergenic
1053765582 9:41393280-41393302 ACTTTAGCCCAGGAGCTCAAAGG + Intergenic
1054321248 9:63668191-63668213 ACTTTAGCCCAGGAGCTCAAAGG - Intergenic
1054544194 9:66304439-66304461 ACTTTAGCCCAGGAGCTCAAAGG + Intergenic
1055958210 9:81794140-81794162 AATTAAAGACTGGAGCCCCAGGG - Intergenic
1057443428 9:95097966-95097988 ACTTTAGCACCCGAGCCCCCGGG + Intergenic
1057567353 9:96177384-96177406 ACTTTAAATCAGGAGTCACAAGG - Intergenic
1060033618 9:120236250-120236272 ATTTTAATACAGCAGCCCTAGGG - Intergenic
1061642993 9:131974371-131974393 AGTCTGACACAGGAGCCTCAGGG - Intronic
1062581177 9:137229921-137229943 GCTGTCACTCAGGAGCCCCAGGG + Intergenic
1202788324 9_KI270719v1_random:55276-55298 ACTTTAGCCCAGGAGCTCAAAGG - Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1188664136 X:32798010-32798032 ACTTTAACAAATCAGCCCCTAGG + Intronic
1190742081 X:53295737-53295759 ACTCCAACACAGCAGCTCCAAGG - Intronic
1194563911 X:95457940-95457962 ACTTTTACATAGTAGGCCCATGG - Intergenic
1195047842 X:101069909-101069931 CCTTTAAAGCATGAGCCCCAGGG - Intergenic
1195757104 X:108210106-108210128 ACTTTGACAGAGGAGGCCCAAGG - Intronic
1197551317 X:127896241-127896263 ACTTTATCAGTGGAGACCCAGGG - Intergenic