ID: 998213298

View in Genome Browser
Species Human (GRCh38)
Location 5:140218008-140218030
Sequence GTTCAATCATGGGAGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998213292_998213298 -7 Left 998213292 5:140217992-140218014 CCATTTCCATTTCCCTGTTCAAT 0: 1
1: 0
2: 4
3: 55
4: 562
Right 998213298 5:140218008-140218030 GTTCAATCATGGGAGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998213298 Original CRISPR GTTCAATCATGGGAGAAAAG TGG Intronic
No off target data available for this crispr