ID: 998214310

View in Genome Browser
Species Human (GRCh38)
Location 5:140225788-140225810
Sequence CTCTATCTCCAGTAGATTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998214310_998214314 22 Left 998214310 5:140225788-140225810 CCGTGAATCTACTGGAGATAGAG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 998214314 5:140225833-140225855 CTCTTCTCTCTGAGTGGCTTTGG 0: 1
1: 0
2: 2
3: 23
4: 304
998214310_998214312 16 Left 998214310 5:140225788-140225810 CCGTGAATCTACTGGAGATAGAG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 998214312 5:140225827-140225849 CTCTTCCTCTTCTCTCTGAGTGG 0: 1
1: 0
2: 2
3: 49
4: 486
998214310_998214315 23 Left 998214310 5:140225788-140225810 CCGTGAATCTACTGGAGATAGAG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 998214315 5:140225834-140225856 TCTTCTCTCTGAGTGGCTTTGGG 0: 1
1: 0
2: 1
3: 30
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998214310 Original CRISPR CTCTATCTCCAGTAGATTCA CGG (reversed) Intronic
900753765 1:4418750-4418772 CTGTATTTCCAGCACATTCATGG - Intergenic
904872489 1:33627525-33627547 CTCTATCTCCACTACAGTGAGGG + Intronic
910169592 1:84363147-84363169 CCCTATCTCAAGTACTTTCATGG - Intronic
912946331 1:114087747-114087769 CACTGTCTCCCCTAGATTCAGGG + Intergenic
916786866 1:168092876-168092898 CTCTATGCCCAGGAGCTTCAAGG + Intronic
917717342 1:177751848-177751870 CTCTCTCTCCATTAGAGGCAAGG + Intergenic
918864203 1:189873672-189873694 TTATGTATCCAGTAGATTCAAGG + Intergenic
920811468 1:209289729-209289751 CTATATTTCCTGTAGATCCAGGG - Intergenic
922169857 1:223144856-223144878 ATTTTTCTCCAGTATATTCAGGG + Intergenic
924134140 1:240945955-240945977 ATCTCTATCCAGTAGGTTCATGG - Intronic
924209370 1:241748763-241748785 CTGTATTTCCAGTAGATACGAGG - Intronic
1066565923 10:36721991-36722013 TTCTATTTCCAGGAGAATCAAGG + Intergenic
1068927986 10:62559619-62559641 CTCTAGCTCCAGTGGAGTCTTGG + Intronic
1071399455 10:85255476-85255498 CTCTCTCTCCATTAGATTGTGGG + Intergenic
1072556238 10:96515984-96516006 CTCTACCTCCAGTTTTTTCATGG - Intergenic
1077628349 11:3793458-3793480 TTCTATTTTTAGTAGATTCAGGG + Intronic
1077770661 11:5215254-5215276 CTGTTTCTCCAGTGGATTCTTGG - Intergenic
1079183937 11:18220006-18220028 TTCTCTCTCCAGTTTATTCAGGG - Intronic
1081020732 11:37945633-37945655 TTATATCTCCAGTAAAATCAGGG + Intergenic
1081088206 11:38826939-38826961 CTCTATTTCCATTTGTTTCAAGG - Intergenic
1082576601 11:54813351-54813373 CTCTTTCTCCATTAGCCTCAAGG + Intergenic
1085893218 11:80605835-80605857 ATCTAACTCTAGTAAATTCAGGG - Intergenic
1093634483 12:21448123-21448145 CTCTTTTTACAGTAAATTCATGG + Intronic
1093935349 12:24994800-24994822 CTCCTTCTCCAGTACATGCATGG - Intronic
1096651244 12:53062934-53062956 CTGTAGATCCAGTAGAGTCATGG + Intronic
1096820531 12:54230350-54230372 GCCTATCTCCATTAGATTCAGGG + Intergenic
1098106837 12:67076502-67076524 TTCTATCTCTAGTATATTTATGG - Intergenic
1098723876 12:73937882-73937904 TAGTATCTCCAGTAAATTCATGG - Intergenic
1100829702 12:98506498-98506520 TTCTATTTCCAGTAGAGACAGGG - Intergenic
1102285755 12:111654977-111654999 CTCTGTCTCCAGTATGTGCAAGG - Intronic
1104866478 12:131958824-131958846 TTTTATCTTCTGTAGATTCATGG + Intronic
1105826684 13:24129460-24129482 CTCTAACTCCAGAAGGTTGAGGG - Intronic
1109869134 13:68308825-68308847 CTTTATCTCTAACAGATTCATGG + Intergenic
1114697740 14:24643542-24643564 CTCTGTCCCCAGTAGAGTCTAGG - Intergenic
1115036566 14:28864461-28864483 ATCTCTTTCCAGTAGAATCAAGG - Intergenic
1116342209 14:43738202-43738224 CTCTATTCCTAGTAGTTTCATGG - Intergenic
1116650376 14:47583984-47584006 CTCTATCTCCTGCATTTTCACGG + Intronic
1119048221 14:71339712-71339734 CTCTATCTTCATTTGTTTCATGG + Intronic
1120589181 14:86355215-86355237 CTGTATCTCCTGTATATTAATGG - Intergenic
1120837800 14:89056828-89056850 CTCTGTTTCCAGGAGACTCAGGG + Intergenic
1128831197 15:70770713-70770735 CTTGATCTCAAGTAAATTCATGG - Intergenic
1131764695 15:95662618-95662640 ATCTTTCTCTAGGAGATTCATGG + Intergenic
1132093377 15:98963857-98963879 CTCTAACTCCAGTGGATTGTTGG + Exonic
1133587648 16:7211493-7211515 CTCTATCACTAGTAAATACAGGG + Intronic
1134131192 16:11651333-11651355 TTCTACCTCCAGAAGATTCCTGG + Intergenic
1135782146 16:25313668-25313690 CCCAAGCTCCAGTAGATCCAGGG - Intergenic
1138427775 16:56947673-56947695 CCCTATCTCCTGTAGCTGCAGGG + Intergenic
1139082430 16:63539441-63539463 GTCTACCCCCACTAGATTCATGG + Intergenic
1139767641 16:69245137-69245159 ATCTATCTCCAGGGGATTCATGG + Intronic
1143093431 17:4463223-4463245 CTGTATTTCCAGTAGAGACAGGG - Intronic
1144271548 17:13622179-13622201 TTCTATCACCAGAAAATTCAAGG - Intergenic
1145285621 17:21504042-21504064 CGCTATCTCCAGTCAATCCAGGG - Intergenic
1145391906 17:22461688-22461710 CGCTATCTCCAGTCAATCCAGGG + Intergenic
1146106831 17:30046483-30046505 CTCTATTTCTTGTAGCTTCAGGG + Intronic
1146612789 17:34322449-34322471 CTCTTTCTTCAATAGCTTCAAGG + Intergenic
1147758189 17:42781786-42781808 CTCCAACTCCAGAAGATTTAGGG + Intronic
1147768902 17:42854541-42854563 CTCCATCTCCAGCAGCTTCCGGG - Exonic
1147771705 17:42872498-42872520 CTCTGTCTCCAGCAGCTTCCGGG - Intergenic
1149382363 17:56106900-56106922 GTCTCTCTTCAGTAGATTCCTGG - Intergenic
1150503256 17:65671504-65671526 GTTTATCTCCAGTTGGTTCAGGG - Intronic
1150981524 17:70147617-70147639 CCCTATCTCCATTTGATTCCTGG - Intergenic
1151298168 17:73201132-73201154 CTCCATCTCCAGTAGCTCCAAGG + Exonic
1152048087 17:77951741-77951763 CTCTATCCCTAGAAGACTCAGGG - Intergenic
1155079855 18:22398035-22398057 CTGTATTTTCAGTAGATACAGGG - Intergenic
1165966005 19:39581495-39581517 CTCTTTCTCCTGCAGATTCAGGG - Intergenic
926891804 2:17645105-17645127 CTCTATTTCCAGCAGACTAATGG + Intronic
929736195 2:44552487-44552509 CTCTATCTGCATAAGATTCCAGG - Intronic
933974451 2:87497179-87497201 CTCTGTCCCCAGCAGATCCAAGG + Intergenic
935709906 2:105889157-105889179 CTCCATCTCCATCAGATGCAGGG + Intronic
936319373 2:111453640-111453662 CTCTGTCCCCAGCAGATCCAAGG - Intergenic
940043448 2:149385059-149385081 CTCTACCTTCAGTAGCTTCGTGG + Intronic
940932397 2:159448884-159448906 CTATATCTCAAGTACATTTATGG + Intronic
941703946 2:168637301-168637323 CTGTATTTTCAGTAGATACAGGG - Intronic
942327713 2:174789648-174789670 CTCTATTTCTATGAGATTCACGG + Intergenic
942402727 2:175620849-175620871 CTCTGTCTCCATGAGATGCAAGG + Intergenic
943430944 2:187800645-187800667 CTCTCTCTCCTGCAGATTCCAGG - Intergenic
944536363 2:200714052-200714074 CTCTATGTCCTGTGGATGCAGGG + Intergenic
944614202 2:201443355-201443377 CTCTCTCTCCAGGAGAGCCAAGG - Intronic
946441295 2:219698871-219698893 CTCAATCTGCAGTGAATTCAGGG + Intergenic
1169392790 20:5203911-5203933 CTCTATTTCTCGTAGATTCCAGG + Intergenic
1172383349 20:34515325-34515347 CGTTATCTCCGGTAGCTTCAGGG - Intergenic
1174175799 20:48644140-48644162 CTCCATCTCCATGACATTCACGG + Intronic
1175599853 20:60264432-60264454 CTGTATCTCCAATTTATTCAGGG - Intergenic
1178414089 21:32389757-32389779 CTCTATCACCAGTGGAGTCGTGG + Intronic
1183240803 22:36656946-36656968 GCCTATCTCCAGTAGAATGAGGG + Intronic
952524012 3:34190774-34190796 CTCTATCTCCAATTCAGTCAGGG - Intergenic
959807080 3:110568252-110568274 CTCAATCTCCAGCACCTTCAGGG - Intergenic
960129690 3:114042516-114042538 CTATATCTTCAGTAAATTCATGG - Intronic
961748429 3:129081112-129081134 CTGTATTTCTAGTAGAGTCAGGG + Intergenic
962061793 3:131935651-131935673 CTGTATGACCAGAAGATTCAGGG + Intronic
964372559 3:156016265-156016287 GTCTATCTGCAGTAGATTTGGGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967463742 3:189778026-189778048 CTGTATTTCCAGTAGAGGCAGGG + Intronic
967760973 3:193226101-193226123 CTGTATCTCCATTAGACCCATGG + Intergenic
969240076 4:5891961-5891983 CTCAAGCGCCAGTAGATTCAAGG - Intronic
970747222 4:19313480-19313502 CTCTATTTCCAGTAGCATGATGG + Intergenic
974308412 4:60172740-60172762 CTCGATCTGATGTAGATTCAAGG - Intergenic
975446028 4:74466549-74466571 ATCTATCTCCAATAGAATCCTGG - Intergenic
975671582 4:76786368-76786390 TTCTATCTACAGGAGATTCGTGG + Intergenic
977543124 4:98342271-98342293 CTCTATGTCCTTTAGATTCTTGG - Intronic
978877020 4:113652725-113652747 CCCTGTCTCCACTACATTCAGGG - Intronic
978917630 4:114146306-114146328 ATCTATTTTCAGTAGTTTCATGG + Intergenic
979316552 4:119271825-119271847 CTCCTTTTCCATTAGATTCAAGG - Exonic
981954721 4:150455857-150455879 CTCTATCTCCATTAGTTCAATGG + Intronic
982025517 4:151250748-151250770 CTTTATCTCCAGCAGACTGATGG - Intronic
982989503 4:162253852-162253874 TTTTATCTACTGTAGATTCATGG - Intergenic
984010110 4:174360440-174360462 CTGTATTTTCAGTAGAGTCAGGG - Intergenic
987987750 5:25170905-25170927 CTCTATCCCCAGTTGGATCAAGG - Intergenic
989188247 5:38645208-38645230 CTCTATGTCCACTTTATTCATGG - Intergenic
994773031 5:104007536-104007558 CTTTATTTCCTGTAGTTTCATGG + Intergenic
996642232 5:125770299-125770321 CTGTTACTCCAGTAGACTCATGG + Intergenic
997801888 5:136871676-136871698 CTCTATTTCCAGCATATTTATGG - Intergenic
997865993 5:137463467-137463489 CTCTATCTCCATTAGTTCAATGG - Intronic
998214310 5:140225788-140225810 CTCTATCTCCAGTAGATTCACGG - Intronic
998547699 5:143045160-143045182 CTCTATCCCCAGGAAAATCAAGG - Intronic
1000281172 5:159783582-159783604 CTCTTTCTCCAGTAGTTGAAAGG + Intergenic
1003079062 6:3006316-3006338 CTAAATCTCCAGAAGATTCCTGG + Intronic
1007540322 6:42636684-42636706 CTCTATCTCTAGTAACTCCAAGG - Intronic
1008303454 6:49871396-49871418 GTTTATGTTCAGTAGATTCATGG - Intronic
1009867616 6:69416995-69417017 CTCCATCTCCAGTAGAATTCTGG + Intergenic
1010481917 6:76365624-76365646 TTCTATCTCCAGTTTATTGAGGG + Intergenic
1014075337 6:117228759-117228781 CTGTATTTCCAGTAGAGACAGGG + Intergenic
1017476324 6:154797566-154797588 CTCTATTTTCAGTAGAGACAGGG + Intronic
1019002451 6:168766232-168766254 CTCTATCTTCAGGACATTCATGG - Intergenic
1025969917 7:66313239-66313261 TTGTATTTTCAGTAGATTCAGGG - Intronic
1026273803 7:68859573-68859595 CTCTATCTACAGTAGACTTGAGG - Intergenic
1028734873 7:94197303-94197325 CTCTTTCTCCAGTATCTGCATGG - Intergenic
1034291981 7:149940155-149940177 CTATACCTCCATTAAATTCAAGG + Intergenic
1034814099 7:154156742-154156764 CTATACCTCCATTAAATTCAAGG - Intronic
1035167149 7:156998627-156998649 CTCTATCTCCATGAGTTCCATGG - Intronic
1038192457 8:25335744-25335766 CTCACTCTCCAGAACATTCATGG - Intronic
1040039961 8:42905911-42905933 CTGTATCTTTAGTAGATACAGGG - Intronic
1040297694 8:46168671-46168693 CTCTATTTCTAGGATATTCAAGG - Intergenic
1041767713 8:61436706-61436728 CTCTATCTCCACTAATTTCTTGG + Intronic
1042067893 8:64899154-64899176 CTTTATCCCCAGTAGTTGCAGGG + Intergenic
1043872234 8:85446403-85446425 CTCTATGGCCAGTAATTTCATGG + Intronic
1043889221 8:85637984-85638006 CTCTATCACCAGGAACTTCAAGG + Intergenic
1044621736 8:94197073-94197095 CTCTATCTCCTGCAGATAGAGGG - Intronic
1051141292 9:13981872-13981894 TTCTATTTCCAGTAGAGACAGGG + Intergenic
1051746656 9:20301156-20301178 CTCTACCTCCAGTATCTTCTTGG + Intergenic
1052002317 9:23300124-23300146 TTCTATTTTTAGTAGATTCAGGG + Intergenic
1052101328 9:24449190-24449212 CTTTATCTCCTGTAGCTGCAGGG - Intergenic
1052224416 9:26067883-26067905 CTCTATCTCCACTTGCTACAGGG - Intergenic
1054762666 9:69016942-69016964 CTCTATCTCCAAAATATTGATGG + Intergenic
1055645843 9:78360524-78360546 CTCCTTCTCCATCAGATTCAAGG + Intergenic
1058243922 9:102600999-102601021 CTCTATCATCAGTAGAAGCATGG + Intergenic
1058928239 9:109689945-109689967 CTCTATCTCCATGACATTCCTGG - Intronic
1186895968 X:14005059-14005081 CTCTATCTACAAGAGTTTCAGGG - Intergenic
1186909982 X:14152620-14152642 CCCTCTCTCCAGTAAATTCCAGG - Intergenic
1188646793 X:32578683-32578705 CCCTGGCTCCAGTAAATTCAAGG - Intronic
1193933630 X:87587619-87587641 CTCTATCCCCAGTTGTTTTAGGG - Intronic
1198396319 X:136222637-136222659 CCCTATCCCCCGTAGATTCTTGG - Intronic
1198506310 X:137304378-137304400 CTCTACCTGCAGTATTTTCAGGG + Intergenic