ID: 998215128

View in Genome Browser
Species Human (GRCh38)
Location 5:140232271-140232293
Sequence TTGTATATAAACCTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998215128 Original CRISPR TTGTATATAAACCTGAAGCT TGG Intronic
902234799 1:15050535-15050557 TTAAAAATAAACCTGAGGCTTGG - Intronic
903388262 1:22944239-22944261 TTGGCTATTAACCTGAAGTTAGG - Intergenic
904887562 1:33752545-33752567 TTCTATAAATACTTGAAGCTGGG - Intronic
905730885 1:40298942-40298964 TTGAATAAAGACCTGAAGCAAGG + Intergenic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
907585435 1:55612785-55612807 TTGTAGATAAACCTTAGGCCAGG + Intergenic
907645612 1:56239848-56239870 TTGTAAATAACCCTTAAGGTAGG - Intergenic
907766574 1:57418456-57418478 TTGTAAATCAATATGAAGCTCGG + Intronic
908557112 1:65266778-65266800 TTGAATATTAACCTTAACCTGGG - Intronic
909523486 1:76596135-76596157 TTGTGTATTAACATGAAGCCTGG + Intronic
912090561 1:106069648-106069670 TTGCATAGAAACATGAAGTTAGG + Intergenic
913235643 1:116779536-116779558 TTGTATAGAAATGTGAAGTTAGG + Intergenic
916712984 1:167428386-167428408 TTGTATACAAACCTGGAAATGGG - Intergenic
920854587 1:209652439-209652461 TTGTTTAAAAACCTGGAGCCGGG - Intronic
1063001704 10:1930698-1930720 TTATACATAAAACTGAAGATTGG + Intergenic
1064136687 10:12756975-12756997 TTGTAAATAAACCTCAAAGTTGG + Intronic
1068091051 10:52432475-52432497 TTGAATAAAAACATAAAGCTTGG + Intergenic
1068114457 10:52721993-52722015 TTGAATATATACCTAAAGATGGG - Intergenic
1068662158 10:59633700-59633722 TTGTTTATAAGACTGAAGCTGGG - Intergenic
1069171003 10:65228704-65228726 TGCTATAAAAACCTGAGGCTGGG - Intergenic
1070259162 10:74837417-74837439 TTCTATAAAAACTTGAAGGTTGG - Intronic
1070562352 10:77577462-77577484 TTGCATAGAAACCTGGATCTTGG - Intronic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1071395020 10:85214033-85214055 TGGTATATTAACCTGTAGATAGG - Intergenic
1072062235 10:91824684-91824706 TTGCAGATTAACATGAAGCTGGG + Intronic
1074391167 10:113059153-113059175 TTGTTTTTGAACCTGAAGTTTGG + Intronic
1074588866 10:114793502-114793524 TTTTATAAATACCTGAGGCTGGG - Intergenic
1075758533 10:124836921-124836943 TTGTGTATAAAATTGAATCTTGG + Intergenic
1078952660 11:16152662-16152684 GTGTCTAAAAACATGAAGCTAGG - Intronic
1079639015 11:22780872-22780894 TTGAATTTAATCCTGAATCTAGG - Intronic
1081363911 11:42212448-42212470 TTATAAATATACCTGAAGATGGG + Intergenic
1084388322 11:68858438-68858460 TTGTAAGTAAACCTGAGGCCGGG + Intergenic
1085708790 11:78810657-78810679 CTGTATATAAACCCCAAGCGTGG - Intronic
1087668612 11:101079989-101080011 TTGTACACAGACCTGAAGCTTGG - Intronic
1092447478 12:8570786-8570808 TTTTATATAAATCTGTACCTTGG + Intergenic
1093850572 12:24031979-24032001 TTGAATATAAACCGGAAGCCAGG + Intergenic
1095221544 12:39621749-39621771 TTTTATATGACCCTTAAGCTAGG + Intergenic
1095613307 12:44158244-44158266 TTGTCTATAAAAGTAAAGCTTGG + Intronic
1095785592 12:46105630-46105652 TTGAAAAGAAACCTGAGGCTGGG - Intergenic
1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG + Intergenic
1103296851 12:119894984-119895006 AAGTATACAAACCTGAAGCTAGG + Intergenic
1105501514 13:20976936-20976958 TTGGATATAAACCAGAAAGTGGG - Intronic
1106096839 13:26653796-26653818 TTGTATATAAGTTTGAAACTAGG - Intronic
1109726672 13:66350048-66350070 TAGTATCTAATCCTGCAGCTTGG + Intronic
1113117920 13:106893253-106893275 TTATATTTAAACCTGAAGTGCGG + Intergenic
1115224904 14:31092363-31092385 TTGAATTTAAACCCAAAGCTTGG - Intronic
1116115859 14:40649800-40649822 TTATATATAAAATTGAAGTTCGG + Intergenic
1117010394 14:51464824-51464846 AGGTATATATACCTGAAGCAGGG + Intergenic
1117724750 14:58661657-58661679 TTGTTTATAAATCTGAAATTCGG - Intergenic
1119851537 14:77869982-77870004 TTTTATAAATACCTGAGGCTGGG - Intronic
1120057367 14:79940358-79940380 TTATATATAAGCCAGAAGCTTGG - Intergenic
1124356980 15:29002972-29002994 GTGTATATATAACTGAAGCGTGG + Intronic
1125633014 15:41163394-41163416 TTGTCGATAATCCTGAAGTTTGG - Intergenic
1125804285 15:42479458-42479480 GTATATATAAACCAGATGCTGGG - Intronic
1126160384 15:45607345-45607367 TTATATATATTCCTAAAGCTTGG + Exonic
1126506536 15:49410915-49410937 TTTTCTAGAAACCTGAAGCATGG + Intronic
1138037271 16:53622062-53622084 TTGTATAAAGATCTGAAGATTGG + Intronic
1141342555 16:83216451-83216473 TTATATATAAACCTCAAATTAGG - Intronic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1149984549 17:61337362-61337384 TTGTAAATAAACCATTAGCTGGG + Intronic
1151102247 17:71569376-71569398 TTGTATACAAAATTGAAGTTTGG + Intergenic
1155189329 18:23415442-23415464 TTTTATTTAAACCTGTAGCCTGG + Intronic
1157319985 18:46626775-46626797 TTGTCTATAAGGATGAAGCTAGG - Intronic
1159276884 18:66233189-66233211 ATGTATATAAACAGGAATCTAGG + Intergenic
1166618047 19:44269171-44269193 TTGTGTATAAACCTAAAACTTGG + Intronic
1167029323 19:46946874-46946896 TTGAAAATAAATGTGAAGCTGGG - Intronic
926080647 2:9983525-9983547 TTGAATAGAAACTTGAAACTGGG + Intronic
926818853 2:16830055-16830077 TCTTTTATAAACCTGCAGCTGGG + Intergenic
927275139 2:21256131-21256153 TAGAATACAAACCAGAAGCTCGG - Intergenic
929755709 2:44762491-44762513 TTTAAAATAAATCTGAAGCTGGG + Intronic
930614531 2:53579498-53579520 TTGAATGTGAACCTGAAGCTGGG - Intronic
930790251 2:55318831-55318853 TTATATTACAACCTGAAGCTTGG + Exonic
931080088 2:58759387-58759409 TGTCATAAAAACCTGAAGCTGGG + Intergenic
933707823 2:85304810-85304832 CTGTATATCACACTGAAGCTAGG + Intronic
934930839 2:98421525-98421547 TTATATCAAAACCTGATGCTTGG - Intergenic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
938969162 2:136416432-136416454 TTAAAAATAAACCTGAAGCCAGG - Intergenic
941250079 2:163150621-163150643 TGGTAAATAATCCTGATGCTGGG - Intergenic
941908461 2:170739667-170739689 TTAGGTGTAAACCTGAAGCTTGG + Intergenic
941942322 2:171053659-171053681 TTGTAAAAAAATCTGTAGCTAGG - Intronic
942385002 2:175433173-175433195 TTGTATTTAAAAAAGAAGCTTGG + Intergenic
942772449 2:179538372-179538394 TTGTAAGGAAACCTAAAGCTAGG - Intronic
945204177 2:207314178-207314200 TTGTAGATAAACCTGATGAAGGG - Intergenic
947685472 2:232080328-232080350 TTGAATATAAGTCTGAAGATGGG + Intronic
948085025 2:235240319-235240341 TCCTAGATAAAGCTGAAGCTAGG + Intergenic
1169493280 20:6089578-6089600 ATGTATGGTAACCTGAAGCTTGG - Intronic
1169792155 20:9422605-9422627 TTATATATAAACACTAAGCTGGG - Intronic
1170048290 20:12111380-12111402 TTGTAAATAAAATTGAAGCAAGG + Intergenic
1170892004 20:20383895-20383917 TTATATTTAAAAATGAAGCTAGG - Intergenic
1172428324 20:34871391-34871413 ATGGATATCAGCCTGAAGCTAGG - Intronic
1177818163 21:26001075-26001097 TTGTATATTTACCTGACCCTTGG + Intronic
1177993329 21:28064945-28064967 TTCTAAATAAACGTCAAGCTTGG + Intergenic
1181547877 22:23613564-23613586 GTGTATAGAAACCTGATTCTGGG - Intronic
1183800248 22:40157083-40157105 TTGGTTTTAAACCTGAAGTTGGG + Intronic
1184860868 22:47172775-47172797 TTGGACCTAGACCTGAAGCTGGG + Intronic
1203288716 22_KI270735v1_random:12279-12301 TTGTATATAAAACTAAATTTTGG - Intergenic
951173951 3:19577286-19577308 TAGGATATGAACCTGATGCTTGG + Intergenic
951630634 3:24716474-24716496 TTGCATATTTACCTCAAGCTTGG + Intergenic
951639883 3:24825399-24825421 TTGGATAATAATCTGAAGCTAGG - Intergenic
952289150 3:31998446-31998468 TTGTAAATAAGCCTGATGCTGGG - Intronic
952909552 3:38170732-38170754 TTGGATATAAACTGGAAGATGGG + Intronic
957287110 3:78231221-78231243 TGGAATTTAAACCTGAAGATGGG + Intergenic
962855748 3:139343375-139343397 TTGGATTTAAACCTGAGGATGGG + Intronic
963326745 3:143871569-143871591 TTGTTTATAAATCTGTAGTTTGG + Intergenic
965297500 3:166968420-166968442 ATATATTTAAACCTGAAGGTAGG - Intergenic
966323543 3:178728777-178728799 TAGTATATACACTTGAAACTTGG + Intronic
967061934 3:185880283-185880305 TCATACATAGACCTGAAGCTGGG + Intergenic
970495537 4:16621222-16621244 GGATATATAAACCTGAAACTGGG - Intronic
970735697 4:19164790-19164812 TGGGGTATAAACCTGAAGATAGG + Intergenic
971270379 4:25138727-25138749 TTGTATATATAACAGAAACTTGG - Intronic
972810898 4:42584781-42584803 TTGAATATATATCTGAAGTTTGG - Intronic
974197332 4:58592454-58592476 TTGAATATGAGTCTGAAGCTAGG + Intergenic
975027757 4:69574015-69574037 TTGAGAACAAACCTGAAGCTGGG - Intergenic
975169273 4:71214473-71214495 TTGTATATAACCCAGAAGTCAGG + Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980447318 4:132927074-132927096 TTATACATAGACCTGAAACTGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981352015 4:143742178-143742200 TTGTATATAAAAACTAAGCTTGG - Intergenic
983260763 4:165453678-165453700 TTGTAAAGAAAATTGAAGCTGGG - Intronic
984727796 4:183037998-183038020 TTGTCAATAATCCTGAAGTTTGG - Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
985936009 5:3098967-3098989 TGTTTTACAAACCTGAAGCTTGG + Intergenic
991271089 5:64782150-64782172 TAGTATATAAACATCAGGCTGGG + Intronic
991322868 5:65395178-65395200 TTTAATATACACCTGAATCTTGG - Intronic
992191329 5:74294848-74294870 TAGAAGAGAAACCTGAAGCTTGG - Intergenic
994428844 5:99629147-99629169 TTGTATTTAAACCTGAGTGTAGG + Intergenic
995380551 5:111527737-111527759 TTGAATATAAACATGAAACAAGG + Intergenic
996836544 5:127799830-127799852 TTGTATTGAAACCTGAATGTTGG - Intergenic
997347980 5:133207159-133207181 TTGAATATAAACAAGAAGTTTGG - Intronic
997827012 5:137115468-137115490 TTATTTATAAAACTGAAGGTTGG - Intronic
998215128 5:140232271-140232293 TTGTATATAAACCTGAAGCTTGG + Intronic
999158510 5:149475662-149475684 TTGGAAATAACACTGAAGCTGGG - Intergenic
999897538 5:156051785-156051807 CTGTGGATAAACCTGAAGTTTGG + Intronic
1003286978 6:4742933-4742955 TTGGACAGAAACCTCAAGCTTGG - Intronic
1004406825 6:15340500-15340522 GTCTTTATAAACCTGAAGGTTGG - Intronic
1005435995 6:25812834-25812856 TTTTATATTAACATGAAGCATGG + Exonic
1008007980 6:46432511-46432533 TTATATATAAAGCTAAAGATAGG - Intronic
1009358315 6:62780690-62780712 TTGAATATAAACGTCAAGCAAGG - Intergenic
1010042598 6:71403815-71403837 TTTTATAGAAACTAGAAGCTCGG - Intergenic
1013181843 6:107723423-107723445 TTGTATAGATACTTGAAGCATGG + Intronic
1013689522 6:112624523-112624545 TTTTATATAAAAAAGAAGCTTGG + Intergenic
1022824977 7:33999744-33999766 TTCTGCATAAACCTGAGGCTTGG + Intronic
1023160125 7:37288820-37288842 TTGTTTATAAACATGAACCTAGG + Intronic
1023374465 7:39542217-39542239 TTATATATTAACCTGATGCAAGG + Intergenic
1028930951 7:96412290-96412312 TTGTTTATAAAAGTGAATCTTGG - Intergenic
1030574505 7:111268897-111268919 TTGTATAGAAATCTGAAGTTTGG - Intronic
1031251078 7:119381194-119381216 ATGTCTATATACCTGGAGCTTGG + Intergenic
1033006634 7:137572050-137572072 TTGTATGTAAATCTGTGGCTAGG - Intronic
1033969941 7:147026207-147026229 GTGTATATAAAATTGAAGATAGG + Intronic
1034302760 7:150030959-150030981 TTGTAAAAAAATCTGAGGCTGGG + Intergenic
1034803300 7:154066353-154066375 TTGTAAAAAAATCTGAGGCTGGG - Intronic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1040784981 8:51155017-51155039 TTGGAGATGAAGCTGAAGCTAGG + Intergenic
1041988988 8:63962384-63962406 TTTTATATAAATCTGAATCTTGG - Intergenic
1043083086 8:75791385-75791407 TTACATAGAAAACTGAAGCTTGG - Intergenic
1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG + Intronic
1044569587 8:93701430-93701452 TTGTCGATAATCCTGAAGTTTGG - Exonic
1047315051 8:123725281-123725303 TTGTACTTAAATCTGAAGTTTGG + Intronic
1049393474 8:142383869-142383891 TTTTTTCTAAACGTGAAGCTTGG - Intronic
1052544604 9:29859495-29859517 ATGTATAAAAACCTGCAGCTAGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1189730746 X:44018001-44018023 TTGTATTTAAACCTGAAAAGTGG + Intergenic
1191191244 X:57670014-57670036 TTTTAAATATACCTGTAGCTTGG + Intergenic
1192611532 X:72572020-72572042 TTGAACATAGCCCTGAAGCTAGG - Intronic
1194414411 X:93592775-93592797 TTGTATATAGATTTTAAGCTTGG - Intergenic
1195054526 X:101130767-101130789 TTGTATTTTAAGCTGCAGCTTGG + Intronic
1195644811 X:107217986-107218008 TTATATATAAATCTGTAGTTAGG + Intronic
1197843278 X:130773409-130773431 TTTTTTAAAAACCTGAGGCTTGG - Intronic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1200785349 Y:7255919-7255941 TTCTTTAAAATCCTGAAGCTTGG - Intergenic
1201522994 Y:14897621-14897643 TTGCATAAACAACTGAAGCTGGG + Intergenic
1201569219 Y:15396705-15396727 TTTTAAATAAACATGAATCTTGG + Intergenic