ID: 998216369

View in Genome Browser
Species Human (GRCh38)
Location 5:140241048-140241070
Sequence TAGAAACAGCAGCTACAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998216369_998216371 -1 Left 998216369 5:140241048-140241070 CCATTTTGTAGCTGCTGTTTCTA 0: 1
1: 0
2: 1
3: 41
4: 490
Right 998216371 5:140241070-140241092 AACCTCTGTCAGCACTGCCTGGG 0: 1
1: 0
2: 3
3: 12
4: 150
998216369_998216370 -2 Left 998216369 5:140241048-140241070 CCATTTTGTAGCTGCTGTTTCTA 0: 1
1: 0
2: 1
3: 41
4: 490
Right 998216370 5:140241069-140241091 TAACCTCTGTCAGCACTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998216369 Original CRISPR TAGAAACAGCAGCTACAAAA TGG (reversed) Intronic
901010171 1:6196412-6196434 TGCAAACAGCATCTACATAAAGG + Intronic
901159484 1:7163952-7163974 TAGAAACTGCAGCTACAGCAAGG - Intronic
904174775 1:28619191-28619213 TAAAAAAAACATCTACAAAATGG + Intronic
904716694 1:32473420-32473442 GAGAATCAGAAGCTAAAAAAAGG - Intronic
906009579 1:42511036-42511058 TAGAAAGAGAAGCGAGAAAAAGG + Intronic
906739846 1:48172413-48172435 TAGCATCAGCATCAACAAAAAGG - Intergenic
908849299 1:68358557-68358579 TAGAACCAGCAGCAAGAAAGAGG - Intergenic
908937577 1:69394631-69394653 TAGCATCAACAGCAACAAAAAGG - Intergenic
908947829 1:69521735-69521757 CAGAAGCAGCAGCTAAAAATTGG + Intergenic
909002708 1:70238300-70238322 TATAAACAGCAGTTAGAACACGG - Intronic
909215234 1:72878311-72878333 TAGAAAAAGCAGGTAGAAGAAGG + Intergenic
910303483 1:85734635-85734657 TACAAACTGCAGATACAGAAGGG - Intronic
910495393 1:87821220-87821242 TAGAAAGTGCAGCTCCAGAATGG - Intergenic
910631558 1:89360683-89360705 TAGCAACAGCAACAACAAACAGG - Intergenic
911342167 1:96652218-96652240 TAGCAACAACATCAACAAAAAGG + Intergenic
912124416 1:106516471-106516493 TAGAAAAAGCAGTAATAAAAAGG - Intergenic
912138053 1:106685410-106685432 TACAAACAGAAGAAACAAAAAGG - Intergenic
913286768 1:117233709-117233731 TAGGATCAACAGCTATAAAAGGG - Intergenic
914410330 1:147421218-147421240 TGGAAACACCAGCTCCCAAAAGG - Intergenic
914817008 1:151070762-151070784 GAGAAACAGAGGCAACAAAATGG - Exonic
915876093 1:159613409-159613431 AAGAAACATCATTTACAAAAAGG + Intergenic
916194537 1:162211033-162211055 TAGAAACAGCAAGAACACAATGG - Intronic
916536411 1:165708087-165708109 CAGAGACAGCAGCAAAAAAAGGG + Intergenic
917913760 1:179678998-179679020 TACCAACAGCATCTACAAAAAGG - Intronic
918328342 1:183431920-183431942 TAGAAACAGCTGCTCAAAAGTGG + Intergenic
918429157 1:184440404-184440426 TACAAACAACAACAACAAAATGG - Intronic
919011240 1:191967538-191967560 TAGAGAAGGCAGATACAAAAAGG + Intergenic
919529131 1:198694255-198694277 TAGAAAAAGCAGGCACAAGAAGG - Intronic
919790484 1:201287254-201287276 TAGACACAGGAACTACAGAAAGG - Intronic
920036830 1:203071528-203071550 TTGAAGGAGCAGCTTCAAAAAGG + Intronic
921403973 1:214758589-214758611 TAGAAAAATAGGCTACAAAATGG - Intergenic
921761557 1:218921256-218921278 AAGAAACAACACCTACAAAACGG + Intergenic
921919790 1:220654993-220655015 TAGCAATAGCTCCTACAAAAGGG - Intronic
921998758 1:221452169-221452191 TAGCAACAACAGCAACAAATGGG - Intergenic
923134493 1:231106104-231106126 TGGAAATAACAGCTACAATATGG + Intergenic
924049311 1:240064295-240064317 AAGAAACAACAACAACAAAAAGG - Intronic
924711127 1:246530834-246530856 TAGAAAGAGAAGCAAGAAAAAGG - Intergenic
924755534 1:246937429-246937451 GAGAAACGGCTGATACAAAAGGG - Intergenic
1062820380 10:530371-530393 TAAGAACAGCAGTTACAAAATGG - Intronic
1062934548 10:1376235-1376257 AATAAACAGCATCTACACAAAGG + Intronic
1063018772 10:2105062-2105084 TAGGAACAGCACATAGAAAAGGG - Intergenic
1064126921 10:12670448-12670470 CAGCAACACAAGCTACAAAATGG - Intronic
1064226711 10:13492580-13492602 TAGAGTCAGCAGCCAGAAAATGG + Intronic
1065093285 10:22255556-22255578 AAGAAACAGCATAAACAAAAAGG - Intergenic
1065364683 10:24923596-24923618 TAGCAACAACATCAACAAAAAGG + Intronic
1066755146 10:38703911-38703933 AAGGAACAGCATCAACAAAAAGG + Intergenic
1067076261 10:43186102-43186124 GAAAAACAGCAGGTGCAAAAAGG - Intergenic
1067194526 10:44104592-44104614 TATTAAAAGCAGATACAAAATGG + Intergenic
1067231032 10:44410903-44410925 TAGTATCAACAGCAACAAAAAGG - Intergenic
1067316638 10:45172584-45172606 TAGAAGCAGCAGCTGCATAGTGG + Intergenic
1067398898 10:45952299-45952321 AAAAAACAGGAGCTACAGAAAGG + Intergenic
1067867217 10:49921535-49921557 AAAAAACAGGAGCTACAGAAAGG + Intronic
1068427277 10:56883279-56883301 TAGCATCAACATCTACAAAAAGG + Intergenic
1068480126 10:57579370-57579392 TAGAAAGAGAAGCGAGAAAAAGG + Intergenic
1069371048 10:67747560-67747582 CAGCAACAGCATCAACAAAAAGG + Intergenic
1071143306 10:82538314-82538336 TAGAAACTGCAGCTAGAAATAGG - Intronic
1071802169 10:89075920-89075942 TATATACAGAAGATACAAAAGGG - Intergenic
1072354580 10:94594804-94594826 TGGAAAGAGCAGCTGCTAAAAGG + Exonic
1072394243 10:95022668-95022690 TAGAATCAACATCAACAAAAAGG - Intergenic
1073416572 10:103388241-103388263 TAAAAACAGTAGCTTCCAAAAGG - Exonic
1074398188 10:113117831-113117853 CAGAAACAGCAGCTACACCCCGG - Intronic
1074463815 10:113664725-113664747 TAGAAATACCTGATACAAAATGG + Intergenic
1074477042 10:113782835-113782857 TAGAAACAGCAGATCCAAAAGGG - Intronic
1074493265 10:113957550-113957572 TAGAAACAGAAGCTAGAAGGCGG - Intergenic
1074841326 10:117354682-117354704 TAGAACGAGCAGCTATAAACAGG + Intronic
1075702973 10:124481285-124481307 TAGTGACAGCTACTACAAAAAGG - Intronic
1075771836 10:124945038-124945060 TTTAAACAGGAGATACAAAAGGG + Intronic
1077618328 11:3695879-3695901 AAGACACCTCAGCTACAAAATGG + Intronic
1078065087 11:8073247-8073269 TAGAATCAGCAGCAGCAAAAGGG + Intronic
1078217849 11:9326884-9326906 TAAACAGAGAAGCTACAAAATGG + Intergenic
1079159643 11:17979894-17979916 CAGACACAGCCGCTAAAAAATGG + Intronic
1079271786 11:18993873-18993895 TAGCAACAACATCAACAAAAAGG - Intergenic
1079931414 11:26567128-26567150 TAGTAACAGAAGCTGGAAAATGG + Intronic
1080180827 11:29424339-29424361 TATAAAAAGCAGCTAAATAATGG + Intergenic
1081262845 11:40982136-40982158 TAGAATCAACAGCTAAGAAATGG + Intronic
1085147538 11:74215044-74215066 TAGAAACAATAGCTATAAATAGG + Intronic
1086268858 11:85035231-85035253 TTGAAACAGCAGATAGAAGATGG + Intronic
1086513933 11:87589913-87589935 TAGCAACAACAACAACAAAAAGG + Intergenic
1086759379 11:90608379-90608401 TAGCAACAACTGCAACAAAAAGG - Intergenic
1086846222 11:91752800-91752822 TTGAAACATGAGCTACATAATGG + Intergenic
1087677883 11:101183372-101183394 TAGGAAATGCAGTTACAAAATGG + Intergenic
1088133295 11:106522339-106522361 TAGAAACAGTAGAAATAAAAAGG + Intergenic
1088656748 11:112006753-112006775 TAGCATCAGCATCCACAAAAAGG + Intronic
1088946285 11:114516741-114516763 AAGGAACAGCATGTACAAAAGGG - Intergenic
1089036528 11:115399471-115399493 TGGATACATCAGCTTCAAAATGG - Intronic
1089589234 11:119529936-119529958 TAGAAACAGCAGCTGGAGGAAGG - Intergenic
1090451293 11:126808591-126808613 CAGAAACATCAGCAGCAAAATGG + Intronic
1090552831 11:127841586-127841608 TAGACACCGCAGGTACAAGAGGG - Intergenic
1090946928 11:131438980-131439002 TAGCATCAGCATCAACAAAAAGG - Intronic
1091026881 11:132149421-132149443 TAAAAACAGCAACAACAAAAAGG + Intronic
1091601121 12:1918297-1918319 TAGAAGCAGCAGCCACAGGAGGG + Exonic
1092491982 12:8953802-8953824 CAGAAGAAGCAGCTACGAAAAGG + Intronic
1092751714 12:11725410-11725432 TTGAAACAGCAGGTTAAAAAGGG - Intronic
1093333309 12:17869330-17869352 TAACAACAACAGCAACAAAACGG + Intergenic
1093709528 12:22314132-22314154 TACAAACAGCTGCTGCAAAATGG + Intronic
1093928239 12:24929975-24929997 TGGAAACAGCAGCTGGAGAATGG - Intronic
1094730074 12:33164230-33164252 TAGCATCAACATCTACAAAAAGG + Intergenic
1094791434 12:33920097-33920119 TAGAATCAACATCAACAAAAAGG - Intergenic
1095352192 12:41226919-41226941 TAAAAACAGCAAGTACAATATGG - Intronic
1095430560 12:42129596-42129618 TAGCAATAACAACTACAAAATGG + Intronic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095594089 12:43939207-43939229 TAGAATCTGCAGCTACTTAAAGG - Intronic
1095699533 12:45176468-45176490 AAGAAACAACAACAACAAAATGG + Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1097619612 12:61923533-61923555 TAGTATCAGCATCAACAAAAAGG + Intronic
1097701095 12:62820715-62820737 TAGCATCAGCATCAACAAAAAGG + Intronic
1098261886 12:68680296-68680318 AAAAAACAGCAGCTAGAAAGGGG + Intergenic
1098415628 12:70231448-70231470 TAGAAACAAAAATTACAAAAAGG - Intergenic
1098891427 12:76013557-76013579 GAGAAACAACAGCTCCAGAAGGG + Intergenic
1098932499 12:76436133-76436155 TATAAACATCAGCTAGGAAAGGG - Intronic
1099588114 12:84546950-84546972 AAGAGACAGGGGCTACAAAATGG - Intergenic
1099967551 12:89465593-89465615 TAGAAACAGAAGCAAAAAATGGG + Intronic
1100204121 12:92329702-92329724 GAGGAACAGCATGTACAAAAGGG + Intergenic
1101055735 12:100911529-100911551 CAGAAAGAGAAGCTACAAAGTGG - Intronic
1101460172 12:104883513-104883535 TAGCATCAACAGCAACAAAAAGG - Intronic
1101815878 12:108145852-108145874 TGAAAAAACCAGCTACAAAAGGG + Intronic
1102188794 12:110970306-110970328 AAGAAGCAGCAGCTTCAGAAGGG + Intergenic
1102331548 12:112036456-112036478 GAGAAAAGGAAGCTACAAAAAGG + Intronic
1103265965 12:119630370-119630392 TAGATAGAGCAGCTACAAGATGG - Intronic
1104542064 12:129675130-129675152 TAGAAGCAGCAGCAAGAAAAGGG + Intronic
1105817333 13:24049019-24049041 TAGACACAGGGGCTACCAAATGG + Intronic
1106428818 13:29659548-29659570 TAGTAACAACAACAACAAAAAGG + Intergenic
1106923501 13:34589296-34589318 TAGAAACAACAGGAACAATAAGG + Intergenic
1107251839 13:38373035-38373057 TAAAAACAACAGCTACCAAGAGG - Intergenic
1107606014 13:42057908-42057930 AAGGAACAGCAGCTGCAAAGAGG + Intronic
1108345743 13:49545459-49545481 TAGAAACAACACCTACATGAAGG + Intronic
1108353476 13:49608352-49608374 TAGAAGCAGCAGCTATACCAAGG - Intergenic
1108796676 13:54040206-54040228 TAGAAACAGAAACCACAGAATGG + Intergenic
1109385839 13:61628472-61628494 TAGCAACAACATCAACAAAAAGG - Intergenic
1109590887 13:64480003-64480025 TAGAAAAAACAGCAAAAAAATGG + Intergenic
1109977677 13:69861304-69861326 TAGAAGCAAAAGCCACAAAAAGG - Intronic
1110321694 13:74167394-74167416 TAGAAACAGCGTCTAGGAAAAGG - Intergenic
1110992470 13:82059929-82059951 GAAAAACAACAGCAACAAAAAGG + Intergenic
1111098033 13:83539949-83539971 GAGAAACAGCAGCTGGAAAGAGG + Intergenic
1111451624 13:88426471-88426493 TAGAAACAGGAGGCACCAAAAGG + Intergenic
1111708460 13:91781239-91781261 AAGAAAATGCAGCTTCAAAATGG - Intronic
1112410923 13:99163060-99163082 CATAAACATCAGCTCCAAAACGG - Intergenic
1112607477 13:100921315-100921337 AAGAGAAAGCAGCTATAAAAAGG - Intergenic
1112784676 13:102938709-102938731 TAGAAAACGCAGCAAAAAAAGGG + Intergenic
1114133442 14:19819879-19819901 TAGCATCAGCATCAACAAAAAGG - Intronic
1115294579 14:31811814-31811836 TAGCATCAGCATCAACAAAAAGG - Intronic
1115466178 14:33716780-33716802 CAGAAACAACAGCAACAAAAAGG - Intronic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115705286 14:35991808-35991830 TACATACAGCAGGTACAAAGTGG - Intergenic
1115778817 14:36746696-36746718 TAGAAACAGGAGATAAGAAAAGG - Intronic
1116288819 14:43006149-43006171 TAAAACCAGAAGCTAGAAAAGGG + Intergenic
1117216118 14:53553541-53553563 TAGAAACAGAAGCTAGAATCCGG + Intergenic
1117837697 14:59824705-59824727 TAGGTACTGCAGCCACAAAAAGG + Intronic
1118238166 14:64030048-64030070 CAGAAACTGCAGGTACTAAACGG + Exonic
1118498558 14:66333692-66333714 TAGTAACAACATCAACAAAAAGG + Intergenic
1118735953 14:68702175-68702197 TAGAAGCAGCAGCTCTACAATGG - Intronic
1121493068 14:94373713-94373735 TAGGAACAACACCAACAAAAAGG - Intergenic
1121615160 14:95308931-95308953 TAGAAACAGAAGAAAAAAAATGG + Intronic
1125076232 15:35621912-35621934 TTGAAACAGCAACAAAAAAATGG - Intergenic
1125311962 15:38389603-38389625 GAGAGACAACAGCTACAAACGGG - Intergenic
1125334109 15:38610929-38610951 GAGAAGCAGCAGGTCCAAAAGGG + Intergenic
1125895261 15:43296640-43296662 TACAAACAGCAGCCAGGAAAAGG - Intronic
1126000368 15:44203871-44203893 TTCAAACAGCAGCTACAACAAGG - Intergenic
1126518929 15:49566952-49566974 TAGAAACAGAAACTAAAGAATGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127108790 15:55645865-55645887 TAGAAAGAACAGCCACAAACAGG + Intronic
1127570698 15:60238105-60238127 TAGAATCAACATCAACAAAAAGG + Intergenic
1127956446 15:63857910-63857932 TAGAGACGGCAGCAACAATAAGG - Intergenic
1128047847 15:64634825-64634847 TGGCAACAGCAGCCACACAAAGG + Intronic
1128370779 15:67037461-67037483 AATAACCAGCAGCTACAAAGAGG + Intergenic
1129015806 15:72467724-72467746 TGGAAACTGCAGATACAAAGGGG - Intergenic
1129563317 15:76593770-76593792 TAGCATCAACAGCAACAAAAAGG + Intronic
1130036754 15:80368018-80368040 TAGAAAGAGAAGCAAGAAAAAGG - Intronic
1130728568 15:86466688-86466710 TAGAATCAACATCAACAAAAAGG - Intronic
1130742373 15:86614601-86614623 TAGTAACAGTAGCTTCAAACTGG - Intronic
1130937910 15:88485645-88485667 TTGTAACAGCAGCAACAAGATGG - Intergenic
1133748325 16:8704495-8704517 AAGAATCAGAAACTACAAAAAGG + Intronic
1134037916 16:11045806-11045828 AAGAAACAGCAGCTTAAAGAGGG - Intronic
1135380509 16:21992538-21992560 TAGAAAAAGCAGGTGGAAAAAGG + Intronic
1138644011 16:58409648-58409670 TTGAAAAAGCAGATACAGAAAGG - Intergenic
1138713129 16:58992420-58992442 TAGCATCAGCATCAACAAAAAGG - Intergenic
1138870203 16:60873892-60873914 TGGAAAAAGCAACTACAAAAAGG - Intergenic
1139940967 16:70605055-70605077 TGGAAACAGCAGGTGCAAAGGGG + Intronic
1140171977 16:72615170-72615192 TAGGAACAACAGGTACATAAGGG + Intergenic
1141371276 16:83488430-83488452 GAGAAACAGAAGCTAGAAATAGG + Intronic
1143133035 17:4692698-4692720 TACAAAAAGCATCTCCAAAAAGG + Intronic
1145986216 17:29048703-29048725 AAGAAACAGCAGCTGCAGAGGGG - Intronic
1146753982 17:35409773-35409795 CAGAAACAGCAGCCTCAAGATGG - Intergenic
1146969958 17:37064682-37064704 TAGAAACAGCGGCTTCAGAATGG - Intergenic
1149093759 17:52816594-52816616 TAGCATCAACATCTACAAAAAGG - Intergenic
1151960131 17:77401434-77401456 TAAAAACAGCCGCGACAAGAAGG + Intronic
1153339333 18:3958223-3958245 TAAAAACAGCAACTATAATATGG + Intronic
1153344145 18:4007925-4007947 CAGAAAAAGAAGCTGCAAAAAGG - Intronic
1153798567 18:8647674-8647696 TAGCATCAACAGCAACAAAAAGG + Intergenic
1154149596 18:11895912-11895934 TAGAAACAGCAGCAGGAAGAAGG + Intronic
1154477359 18:14775767-14775789 TAGAAGCAGCAGCTGCATAGTGG + Intronic
1154481982 18:14838655-14838677 TAGAAGCAGCAGCTGCATAGTGG + Intronic
1155373754 18:25134104-25134126 TATAAACAGCAACTACAAACAGG + Intronic
1159568517 18:70084494-70084516 TAGAAACAGCTTCTGCAAGAAGG - Intronic
1160601182 18:80013851-80013873 TAGGAACAACAACAACAAAAAGG + Intronic
1161831650 19:6609647-6609669 CAAAAACAACAGCAACAAAATGG + Intergenic
1163050187 19:14677260-14677282 TAGATACAACAGGAACAAAAAGG + Intronic
1163300717 19:16444326-16444348 TAGCAACAGCAGCCCCAAGATGG + Intronic
1163769379 19:19181506-19181528 TTGAAACAGCAGGCACAAACAGG + Intronic
1163869978 19:19812678-19812700 TAGAATCTGCAGATAAAAAAGGG - Intronic
1164110195 19:22149314-22149336 TAGAAGCAACATCAACAAAAAGG + Intergenic
1164112840 19:22185313-22185335 TAGAAGCAACATCTACAAAAAGG + Intronic
1164195179 19:22950462-22950484 TAGAAGCAACATCAACAAAAAGG + Intergenic
1164197108 19:22978805-22978827 CAGAAGCAACATCTACAAAAAGG + Intronic
1164677766 19:30113249-30113271 TTAAAACAGCAGCAACAAAATGG + Intergenic
1166610903 19:44195314-44195336 TAGAAGCAGAGGCCACAAAAGGG + Intergenic
1168092404 19:54094936-54094958 TAGTAGTAGCAGCTACAGAAAGG - Exonic
925986726 2:9222439-9222461 CAGAAACAGCAGCTTGGAAAGGG - Intronic
925989464 2:9242470-9242492 TAGACACAGCAGCTAGAGTATGG - Intronic
926484327 2:13436443-13436465 TAGGAACATCACCTGCAAAAGGG + Intergenic
929313227 2:40449854-40449876 GAAAAACAACAGCAACAAAAAGG - Intronic
929316722 2:40488091-40488113 TAGAAGCAAGAGCTACTAAAAGG + Intronic
931798152 2:65731764-65731786 TAGACATGGCAGCTAGAAAATGG - Intergenic
932031427 2:68190106-68190128 TAAAAACTACAGCTACAAGATGG + Intronic
932899611 2:75682392-75682414 TAGTATCAGCATCAACAAAAAGG + Intronic
933112051 2:78414899-78414921 TAGACACAGGAACTCCAAAAGGG + Intergenic
933488171 2:82949771-82949793 TAGCATCAACAGCAACAAAAAGG - Intergenic
933501200 2:83113915-83113937 TAGAAAAAGCAAATACAAGAAGG + Intergenic
934318437 2:91948144-91948166 AAGGAACAGCATCAACAAAAAGG + Intergenic
934707627 2:96495651-96495673 CAGAAACAGCAGCAACAAACTGG - Intergenic
935563447 2:104582105-104582127 TAGAGACACCAGCTACAAACTGG + Intergenic
936167200 2:110131590-110131612 CAGAAACAGAAGATACAAGATGG + Intronic
936841666 2:116777061-116777083 TAGAAACAACAGAAACAAAAAGG + Intergenic
938232831 2:129676495-129676517 TAAAAACACAAGCTACAGAATGG - Intergenic
939010220 2:136837687-136837709 TAGAAACAGCATCTAGAATATGG + Intronic
939028972 2:137047534-137047556 TAGGAAGAGGAGCTAAAAAAAGG + Intronic
939191409 2:138920804-138920826 GAGAAACAGCAGATACAGGAAGG + Intergenic
940370659 2:152896823-152896845 TAGAATCAACATCAACAAAAAGG + Intergenic
940414964 2:153408936-153408958 TAGAAACAGCAGGCAGAAGAAGG + Intergenic
940731389 2:157397065-157397087 TAGCAACAGAAGCAACAGAAGGG + Intergenic
941517143 2:166493938-166493960 TGGACACAGCAGCAAGAAAAAGG + Intronic
943010941 2:182448265-182448287 TAGAAACATGTGCTCCAAAATGG - Intronic
943038377 2:182774026-182774048 TAGCATCAGCATCAACAAAAAGG - Intronic
943949750 2:194117710-194117732 TATAAACAACAACAACAAAAAGG + Intergenic
944119896 2:196229665-196229687 AAAGAACAGCAGCAACAAAAAGG + Intronic
945504535 2:210622503-210622525 TAGAAACAGTAGCCAATAAAGGG + Intronic
945817433 2:214622969-214622991 AAGAAACAGCACCTTCAAATTGG + Intergenic
946626679 2:221619595-221619617 TGTAAACAACAGCTATAAAATGG + Intergenic
947204321 2:227646275-227646297 TAAAAACAGGAGCTACAAACTGG - Intergenic
947476588 2:230454436-230454458 TAGCAAAAGCAGTTACAAGAGGG - Intronic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1169605982 20:7319576-7319598 AAGGAACAGCATCAACAAAAAGG + Intergenic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1170530987 20:17291313-17291335 TCTAAACAGCAGGTACACAATGG - Intronic
1171494317 20:25544722-25544744 TGAAAAAAGCAGCCACAAAAAGG + Intronic
1175131526 20:56793355-56793377 TAAAAACAGAAACTCCAAAAGGG + Intergenic
1175682394 20:60999261-60999283 TATAAACAGAAACTAGAAAATGG + Intergenic
1178111379 21:29373298-29373320 TAGAAACAAGAGCTCCACAAAGG + Intronic
1178233865 21:30819693-30819715 TAGATATAGAAGCTTCAAAATGG + Intergenic
1178991703 21:37362153-37362175 TAGTAACAACAACAACAAAAAGG + Intergenic
1179473738 21:41630263-41630285 AAGAAAAAGCAACAACAAAATGG + Intergenic
1179558551 21:42196408-42196430 TAGAAACACCACATACCAAAAGG + Intergenic
1180306621 22:11131826-11131848 AAGGAACAGCATCAACAAAAAGG + Intergenic
1180545139 22:16494009-16494031 AAGGAACAGCATCAACAAAAAGG + Intergenic
1181186484 22:21110148-21110170 TAGAAATAACAGGTAGAAAAGGG - Intergenic
1181839427 22:25643557-25643579 CAGAAACAGAAGCTGCAGAAAGG - Intronic
1181913754 22:26262507-26262529 TAGCACCAGCAGCTGCAATATGG - Intronic
1182342377 22:29633849-29633871 TAGACACTGATGCTACAAAATGG - Intronic
1183329999 22:37214255-37214277 CAGAAACAGCAGGTGCAGAAAGG + Intergenic
1183720965 22:39561111-39561133 CAGGCACAGCAGCTCCAAAAGGG - Intergenic
949345062 3:3068827-3068849 TAGTAACTGCAACTATAAAATGG + Intronic
949690999 3:6639020-6639042 TGGAGACAGAACCTACAAAATGG + Intergenic
949869513 3:8575969-8575991 TACAAACAACAGCAACAACAAGG - Intergenic
951076756 3:18402785-18402807 TAGCAAGAGCATCTACAAAATGG + Intronic
951653623 3:24980960-24980982 TAGCATCAGCATCAACAAAAAGG - Intergenic
951826778 3:26876793-26876815 TAGCATCAGCATCAACAAAAAGG + Intergenic
952089715 3:29869957-29869979 TAGAAACAGAAACTGAAAAAAGG - Intronic
952974089 3:38679361-38679383 CAGAGACAGCAGCTAGAAGAGGG + Intergenic
954739349 3:52735080-52735102 TAGGAAAAGCAGCTTCTAAATGG - Intronic
955469806 3:59274667-59274689 TAAACAGAGCAGCTACAGAAGGG - Intergenic
956008013 3:64801113-64801135 CAGAAACAACAACAACAAAACGG + Intergenic
957155445 3:76538492-76538514 TAGCAACAGCAGTTAAACAATGG - Intronic
957262883 3:77922981-77923003 TAAAAACAGCAGCTAGGAAAGGG + Intergenic
957642841 3:82880503-82880525 TAGCAACTGCACCTACAACAGGG - Intergenic
957679579 3:83416399-83416421 TAGAAAAGACAACTACAAAAGGG - Intergenic
957725840 3:84065476-84065498 TACAGACTGTAGCTACAAAATGG + Intergenic
957786200 3:84885913-84885935 TAGCATCAACATCTACAAAAAGG + Intergenic
958185911 3:90118690-90118712 AAGAAACAGCATCTAGTAAATGG + Intergenic
958907374 3:99956711-99956733 AAGAAACTACAGCTACAGAAGGG - Intronic
959115238 3:102169689-102169711 TAGAACCACCATCTACAGAAAGG - Intronic
959290614 3:104469018-104469040 AAGGAACAGCATCAACAAAAGGG - Intergenic
959426739 3:106198975-106198997 TTGAGACAGCAGCCAAAAAAAGG - Intergenic
959534715 3:107471310-107471332 TAGCATCAGCATCAACAAAAAGG + Intergenic
959693006 3:109219524-109219546 TAGAATCAACATCAACAAAAAGG + Intergenic
959854751 3:111138675-111138697 AAAAAACAGCAGCTATTAAAAGG - Intronic
960337181 3:116433028-116433050 AACAAACACCAGCTACAAATTGG + Intronic
961220588 3:125196006-125196028 GTGAAACATCAGCTGCAAAAAGG + Intronic
962970172 3:140393433-140393455 CAGAAACAGAAGCTACACATAGG - Intronic
963174235 3:142281510-142281532 TAGAAAGAGAAGCAAGAAAAAGG - Intergenic
963496496 3:146069543-146069565 TAAAAACAGTAGCTACAATAAGG + Exonic
963976424 3:151484748-151484770 TAGAATCAACATCAACAAAAAGG + Intergenic
965221487 3:165932043-165932065 TAGCATCAACAGCAACAAAAAGG + Intergenic
965497374 3:169414334-169414356 TAGCATCAACATCTACAAAAAGG + Intronic
965584743 3:170307548-170307570 TATAAACACTAGCTACAATATGG - Intergenic
965906415 3:173712541-173712563 AAGAAACATAAGCTTCAAAAAGG - Intronic
965995001 3:174870838-174870860 CAGATACATCAGCTATAAAAGGG - Intronic
966050833 3:175616836-175616858 TAAAAGCAGAAGCTACGAAAGGG - Intronic
966440788 3:179942269-179942291 CAGAAATAGCAGCCACGAAAAGG - Intronic
967760348 3:193217280-193217302 TAGAAAAAGCAGGTAGAAGAAGG - Intergenic
967898679 3:194424331-194424353 AAGAAACATCAGTTCCAAAAAGG + Intronic
968048865 3:195640235-195640257 GAAAAACTGAAGCTACAAAATGG + Intergenic
968098534 3:195949391-195949413 GAAAAACTGAAGCTACAAAATGG - Intergenic
968305751 3:197649688-197649710 GAAAAACTGAAGCTACAAAATGG - Intergenic
970840886 4:20467728-20467750 TAAAAACAACAACAACAAAAAGG - Intronic
973341757 4:49012668-49012690 TAGCATCAGCATCAACAAAAAGG - Intronic
973571788 4:52247729-52247751 TAGAAAGAGGAACTAGAAAAAGG + Intergenic
973692716 4:53454734-53454756 TAAAAACACCAGCTACATTAAGG + Intronic
973837587 4:54825648-54825670 TAGCATCAACATCTACAAAAAGG + Intergenic
974158863 4:58110846-58110868 AAAAAACAACAGATACAAAAAGG - Intergenic
975367467 4:73545387-73545409 TAGTATCAGCATCAACAAAAAGG + Intergenic
975524352 4:75332250-75332272 TAGCATCAACAGCAACAAAAAGG + Intergenic
975548197 4:75582323-75582345 GAGAAACAGATGCTATAAAAGGG + Intronic
976043305 4:80913627-80913649 TTGAAACAACAGTTACAGAAGGG + Intronic
976183956 4:82427243-82427265 CAGCAACAGCAACAACAAAAAGG - Exonic
976231535 4:82848871-82848893 GAGAAACAGCAGCTCCCCAAGGG - Exonic
977056897 4:92203799-92203821 AATAAACAGCAGATAAAAAATGG - Intergenic
977950941 4:102969432-102969454 AAGGAACAGCATCAACAAAAAGG + Intronic
979043107 4:115824963-115824985 TATAAACAGAAGCTAAACAATGG - Intergenic
980247077 4:130260499-130260521 TAGAAACTTAAGATACAAAAGGG - Intergenic
981025871 4:140076624-140076646 CAGAATCAGCAGCTAAGAAAAGG - Intronic
981026806 4:140084984-140085006 TAGCAACAGCAGCCACAACAAGG - Intronic
981310815 4:143296289-143296311 AAGAAACTGCAGCAGCAAAAAGG - Intergenic
981597080 4:146437423-146437445 TTGAAACAGCATCTATAAGATGG + Intronic
981784867 4:148465782-148465804 TGGGAACAGCAGCATCAAAAAGG - Intergenic
982542813 4:156695755-156695777 TAGACACAGAAGCTACAAGAGGG - Intergenic
983313733 4:166099166-166099188 TAGAAACAGAAGTTAGACAATGG + Intronic
983435901 4:167714816-167714838 TAGAAACATCACCTAAAAGAAGG - Intergenic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
984175250 4:176409676-176409698 TAAAAACAACAGATACAAGAGGG + Intergenic
984618751 4:181927974-181927996 TAGAATCAACATCAACAAAAAGG + Intergenic
984780776 4:183523938-183523960 GAAAAACAGCAACAACAAAATGG - Intergenic
985365352 4:189225850-189225872 GAAAAACAACAACTACAAAAAGG + Intergenic
985505346 5:276696-276718 GAAAAACTGAAGCTACAAAATGG + Intronic
985742779 5:1628904-1628926 GAAAAACTGAAGCTACAAAATGG - Intergenic
987020039 5:13860740-13860762 CAGAAACACCACATACAAAATGG - Intronic
987347642 5:16992734-16992756 TAAAAACGGCAGCAAAAAAATGG - Intergenic
987687688 5:21226206-21226228 TAGTAACAACACCAACAAAAAGG + Intergenic
988516531 5:31909552-31909574 AATAAACAAGAGCTACAAAAAGG + Intronic
988671130 5:33383086-33383108 AAGAAACAGCAGAAACAAGAAGG + Intergenic
988795033 5:34645874-34645896 TAGCATCAGCATCAACAAAAAGG - Intergenic
989022289 5:37022603-37022625 AAGAAACAGCAACTGAAAAAAGG - Intronic
989614652 5:43328063-43328085 TAGCATCAACAGCAACAAAAAGG - Intergenic
989667604 5:43874421-43874443 TAGAAACTGCAGCCACAGATCGG + Intergenic
990425075 5:55679760-55679782 TAGAAAGAGCAGTTCCAAATGGG + Intronic
990899019 5:60729814-60729836 TAGCATCAACAGCAACAAAAAGG + Intergenic
991929743 5:71742028-71742050 GAGAAACAGCAGATTCAAGAAGG - Intergenic
992992604 5:82299254-82299276 TTGAAATTGCAACTACAAAAAGG - Intronic
993292740 5:86095982-86096004 TAGAAAAAACAATTACAAAAGGG + Intergenic
993455399 5:88121181-88121203 TAGCAACAACATCAACAAAAAGG + Intergenic
993570496 5:89532611-89532633 TAGAAACATCAACAACCAAAAGG - Intergenic
993775345 5:91987966-91987988 TAGAAAGAGAAGCTACAGACTGG + Intergenic
993955121 5:94223151-94223173 AAGCAACAGCAACAACAAAAAGG - Intronic
993990409 5:94650117-94650139 TAGCAGTAGCAGCCACAAAAAGG + Intronic
994350114 5:98735853-98735875 TATAAACAGCAGCAACCTAAAGG + Intergenic
994355030 5:98785212-98785234 TTGAAACAGAAGGTACTAAAGGG + Intronic
994571018 5:101513790-101513812 TATAAACAGCCTCTAGAAAATGG - Intergenic
994628633 5:102253465-102253487 TAGACACTGCAGATACAAGAGGG + Intronic
995040572 5:107583653-107583675 TAGAAAAAGGATCTACATAATGG + Intronic
995815823 5:116166792-116166814 TAGAATCAACATCAACAAAACGG + Intronic
996002348 5:118379638-118379660 TAGAAATATCAGCCACAAACTGG - Intergenic
996288733 5:121827122-121827144 AAGCAACAGCAGATAAAAAAGGG - Intergenic
996334371 5:122366956-122366978 GAGAAACAGCAGTAAGAAAATGG + Intronic
996958080 5:129209495-129209517 AAGAAACTGCAGCTACTAATGGG - Intergenic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
998472643 5:142395227-142395249 TAGGAACAGAAGCAAAAAAATGG + Intergenic
998478562 5:142442208-142442230 CAGGAACTGCAGATACAAAATGG - Intergenic
998715241 5:144876118-144876140 TAGACACAGCTGCTAAAAGAAGG - Intergenic
998751984 5:145332962-145332984 TAGAATCAACATCAACAAAAAGG - Intergenic
998985938 5:147756761-147756783 TGGAAACAGCAGCTACCACATGG - Intronic
999734721 5:154504465-154504487 TAAAAACAGCAGCAATAACAAGG + Intergenic
1000591700 5:163165987-163166009 TAGCAACAGCGTCAACAAAAAGG + Intergenic
1000734056 5:164876361-164876383 TAGAAACAATAGCACCAAAAGGG - Intergenic
1001731112 5:173959633-173959655 TAGAAACACCAGCAAGAAAGAGG - Exonic
1002657592 5:180763157-180763179 TAAAAACAACAACAACAAAATGG + Intergenic
1003311586 6:4973920-4973942 TGAAAACAGCAGTTGCAAAACGG + Intergenic
1003313967 6:4994683-4994705 TATAAACAGCACTTACAACAGGG + Intergenic
1003732625 6:8843002-8843024 CAGATATAGCAGCTACAAAATGG - Intergenic
1004701953 6:18087642-18087664 TACAAACAGCAGCTATAAAGTGG + Intergenic
1004791572 6:19032702-19032724 AAAAAACAGCAGCTAAATAAAGG - Intergenic
1004892959 6:20119233-20119255 TAGAAACAGGAGCTTTTAAAGGG - Intronic
1005236500 6:23768099-23768121 TGGACACAGCAGCTCTAAAAAGG - Intergenic
1005472782 6:26178310-26178332 TAAAAACAGCAGATGCAAGAAGG - Intergenic
1006017258 6:31091848-31091870 TTTAATCAGCAGCTTCAAAATGG - Intergenic
1006895133 6:37463318-37463340 TACAAACAGCAGCAATTAAAGGG - Intronic
1008389056 6:50928264-50928286 TAGCAACAGCAGTGACAACAGGG - Intergenic
1009222123 6:60995184-60995206 TAAAAACAGTATCAACAAAAGGG - Intergenic
1009529160 6:64787937-64787959 TAAAAACAACAGTTACAAAGGGG - Intronic
1011063074 6:83293435-83293457 TAGAAACAGAAACTAGAAAGTGG - Intronic
1011655690 6:89549824-89549846 TAGAAACATCAGCTACATCAAGG + Intronic
1012216748 6:96595862-96595884 GAGAAATAACAGATACAAAATGG - Intronic
1012590069 6:100969644-100969666 TAGAATCAACATCAACAAAAAGG + Intergenic
1012683632 6:102214613-102214635 TAAAAACAGAAACAACAAAAAGG - Intergenic
1013262770 6:108462538-108462560 TTGAAACAGCACCTATAAAGTGG + Intronic
1013336831 6:109172075-109172097 TAAAATCAGCAGCTGAAAAAAGG + Intergenic
1013453108 6:110304113-110304135 TAGAATCAACATCAACAAAAAGG + Intronic
1013494256 6:110682471-110682493 TATAAAGAGCAGCTTCCAAAAGG - Intronic
1013816352 6:114103075-114103097 AAGAAACAGAAGCCATAAAAGGG - Intronic
1014609922 6:123529520-123529542 TAAAAACAACAGCAACAACATGG + Intronic
1015047002 6:128788000-128788022 TAGTATCAGCATCAACAAAAAGG + Intergenic
1016092148 6:139993127-139993149 TTGAAACAGTGCCTACAAAAGGG + Intergenic
1016377870 6:143442369-143442391 TAGAAGCTGCAGCTATAAAGAGG + Intronic
1017231445 6:152077789-152077811 TAAATACAGCAGCTCCAAATGGG - Intronic
1020244024 7:6416787-6416809 TAAAAACAACAGCTCCAAAGAGG + Intronic
1020822309 7:12985409-12985431 CAGAAGCAGTAGCTACACAAAGG + Intergenic
1021482947 7:21137807-21137829 AAGAAACAACAACAACAAAAAGG - Intergenic
1021485947 7:21168674-21168696 TGGAGACAGCATTTACAAAAAGG - Intergenic
1022129509 7:27391549-27391571 TAGAAGCAGCAGCAACAACCTGG + Intergenic
1022999350 7:35791503-35791525 TAGAAAAAGCAGCACCAAAAAGG - Intergenic
1023376775 7:39564163-39564185 TAGAAATAGAAACTACAAATTGG - Intergenic
1023726090 7:43143663-43143685 TTGAAGCAGCAGCTGCATAAGGG - Intronic
1024817406 7:53287522-53287544 TAGAATCAACATCAACAAAAAGG - Intergenic
1026167799 7:67925799-67925821 TGGGAAGAGCAGCTACAAATGGG + Intergenic
1027171431 7:75875629-75875651 TACAAACAACAACAACAAAAAGG + Intronic
1027183306 7:75954373-75954395 TATAAACAGCAGATAGAAAAGGG - Intronic
1027431434 7:78117142-78117164 TGTAAACAACAGCAACAAAAAGG + Intronic
1027449777 7:78317915-78317937 TAGCATCAGCATCAACAAAAAGG + Intronic
1027471383 7:78578611-78578633 GAGAAATAGAAGATACAAAAAGG + Intronic
1027705057 7:81520041-81520063 TAGAAACAGCACCTCAGAAATGG - Intergenic
1029817088 7:103107195-103107217 TAGTATCAGCATCAACAAAAAGG + Intronic
1030116767 7:106067705-106067727 AAAAGACAGCAGCTGCAAAAAGG + Intergenic
1030325740 7:108217112-108217134 TAGCATCAGCATCAACAAAAAGG - Intronic
1031216694 7:118901537-118901559 GAGAAACAGCAGCCACAGGATGG - Intergenic
1031430575 7:121663639-121663661 ATGAAACAGCTTCTACAAAAAGG + Intergenic
1031727146 7:125254132-125254154 TAGAAACTGGAACTGCAAAATGG + Intergenic
1032312477 7:130801725-130801747 TAGCAACAACATCAACAAAAAGG - Intergenic
1032738887 7:134719287-134719309 TAGAAAGAGGAGAGACAAAAAGG + Intergenic
1032928227 7:136634429-136634451 TACCAACAGGATCTACAAAATGG - Intergenic
1033352477 7:140572858-140572880 TAAAAACAGCAGGTGCACAAAGG + Intronic
1033828388 7:145220667-145220689 TAGAAACAGGAGCAAAACAAGGG - Intergenic
1033926271 7:146464940-146464962 CAGAAAAGGCAGCTAGAAAATGG - Intronic
1034591375 7:152142441-152142463 TAGTAACACCAGCTACAAATGGG + Intronic
1035408193 7:158614731-158614753 TAAAAACAACACCTACAAATTGG + Intergenic
1036040397 8:5073239-5073261 TATAATAAGCAGCTACAAAGTGG - Intergenic
1036403821 8:8435843-8435865 AAGAAGTATCAGCTACAAAAGGG - Intergenic
1036913640 8:12783493-12783515 TACAAACAGAAGCTAAAAGATGG - Intergenic
1037158098 8:15731067-15731089 TATAAATAGCAGCTTAAAAAAGG + Intronic
1037498425 8:19462723-19462745 TAGAGAAACCAGCTAAAAAATGG - Intronic
1038089050 8:24233524-24233546 TAGAAACAGCATCAAGAAACGGG - Intergenic
1038120214 8:24604735-24604757 AAGAAACAGGAGCTAATAAAAGG + Intergenic
1038601117 8:28943573-28943595 GAAAAACAGCAGATACAAGAAGG - Intronic
1038667929 8:29557349-29557371 TATAAACACCAGCTACACACAGG + Intergenic
1040346290 8:46500866-46500888 CAGAGACAGATGCTACAAAACGG + Intergenic
1040928717 8:52713377-52713399 TAGAAATAGCAGCTTCTGAATGG - Intronic
1040943540 8:52856952-52856974 TAGCAACAGAAGTGACAAAATGG - Intergenic
1041605261 8:59774607-59774629 GAGAAATAGCAGATACAAAAAGG + Intergenic
1043999329 8:86859436-86859458 TATAAACAGTAGCTAAATAAGGG + Intergenic
1044528162 8:93275843-93275865 AAGATACAGGAGCTACAACAAGG + Intergenic
1045226185 8:100248223-100248245 AAAAAACAGCTGATACAAAAGGG - Intronic
1045574780 8:103408689-103408711 TAGTAAGAGCAGCTTCAGAAGGG - Intronic
1045706972 8:104935421-104935443 GAGAAACAGCAGTTGCAAACTGG + Intronic
1046298629 8:112256776-112256798 AACAAACAGCAACAACAAAATGG + Intronic
1046847219 8:118931160-118931182 CAGCAACAGCAACAACAAAACGG + Intronic
1046852640 8:118992974-118992996 GAGAAACAGCAGCTCTACAATGG + Intergenic
1047067449 8:121301266-121301288 TAGAAATAGAAGCTTCATAAAGG + Intergenic
1047074479 8:121384916-121384938 GAGAAACAGAAGCTCCAAAGGGG - Intergenic
1047132622 8:122038048-122038070 TACAAATAGTAGCTCCAAAAGGG + Intergenic
1047535301 8:125713807-125713829 TTCAAACACCAGTTACAAAAAGG + Intergenic
1047545259 8:125810399-125810421 TAGATCCAGCAGCTGCAAAAAGG - Intergenic
1047750577 8:127877294-127877316 CAGAAACAGCAGCGTGAAAAGGG - Intergenic
1047876425 8:129142903-129142925 TAGCAATAGCAGATACAGAAGGG - Intergenic
1048160496 8:132016482-132016504 TAGAAAGAGGGGCTGCAAAAGGG + Intergenic
1048325951 8:133439063-133439085 TAGATACAGAATCTACAAATAGG - Intergenic
1048346925 8:133582993-133583015 TAGAACCAGCAGCAACTAAATGG - Intergenic
1049167334 8:141134744-141134766 AAGACACAGCAGTGACAAAAGGG - Intronic
1051158751 9:14181933-14181955 TAGTTACAGCAACTTCAAAATGG + Intronic
1051795628 9:20866317-20866339 TGGAAACAACATCTAAAAAATGG - Intronic
1051814421 9:21088159-21088181 TAGCATCAGCATCGACAAAAAGG + Intergenic
1051863282 9:21651045-21651067 TAGCATCAGCATCAACAAAAAGG - Intergenic
1052367230 9:27626410-27626432 TAGAAATGCCAGCTCCAAAAAGG + Intergenic
1052480840 9:29023546-29023568 CAGATACAGTAGTTACAAAATGG + Intergenic
1052627365 9:30993769-30993791 TAGCAACAGCAGCCACAATTTGG + Intergenic
1053053540 9:34980219-34980241 TAGAGGCAGCAGCTCCAAAGAGG - Exonic
1055239339 9:74164570-74164592 TAGCTACAGCATCAACAAAAAGG + Intergenic
1055450159 9:76423844-76423866 TAGAAACACCAACAACAAAAAGG - Intronic
1056129480 9:83569567-83569589 TGGAAACAGCAGCAATCAAATGG - Intergenic
1056341151 9:85633775-85633797 TACAAATGTCAGCTACAAAAGGG - Intronic
1056699901 9:88893726-88893748 TATAAACAGGAGCTAAACAATGG - Intergenic
1057484691 9:95473414-95473436 TGGAAAGAGAAGCTACATAATGG + Intronic
1058063249 9:100521851-100521873 TGGAAACAGCATCTCTAAAAAGG - Intronic
1058202913 9:102066375-102066397 TAGCATCAACAGCAACAAAAAGG - Intergenic
1058891796 9:109367442-109367464 AAGAAACACAAGTTACAAAATGG - Intergenic
1059468763 9:114487744-114487766 TAGATACAGGAACTACAAAAGGG - Intronic
1059849613 9:118322680-118322702 CAAAAACAACAGCAACAAAAAGG - Intergenic
1059919158 9:119138407-119138429 TGGAAACAGCACCTTGAAAAAGG + Intergenic
1062307654 9:135918603-135918625 TAGAAAGACAACCTACAAAATGG + Intergenic
1185652352 X:1657648-1657670 AAGAAACAGCAGCAGCACAAAGG + Intergenic
1185778619 X:2826393-2826415 TAGACACTGGAGATACAAAAGGG + Intergenic
1185970026 X:4652461-4652483 TAAAAACAACAACAACAAAATGG - Intergenic
1186060156 X:5696169-5696191 GAGGAACAGCATCTAAAAAAGGG + Intergenic
1186258378 X:7747535-7747557 TAGAGGCAGCAGAAACAAAATGG + Intergenic
1187256711 X:17649843-17649865 AAGAAATAGCTGCTATAAAATGG - Intronic
1187875944 X:23804220-23804242 GAAAAACAGCAGATACAAGAAGG + Intergenic
1188092277 X:25977710-25977732 CAGAATCAGCAACAACAAAATGG + Intergenic
1188227620 X:27620886-27620908 TATTAACAGCAGCTAAAATATGG + Intronic
1188296471 X:28456132-28456154 TAGCAACAACATCAACAAAAAGG + Intergenic
1188640623 X:32498439-32498461 TAAAAAGAGAAGCTACTAAAAGG - Intronic
1188703608 X:33298117-33298139 TCATTACAGCAGCTACAAAAAGG + Intronic
1189457354 X:41204912-41204934 TATATACAACAGCTACACAAAGG + Intronic
1189765702 X:44369934-44369956 GAGAAACAGCAGGTACAGAAAGG + Intergenic
1189766203 X:44374855-44374877 GAGAAACAGCAGGTACAGAAAGG + Intergenic
1189964685 X:46360725-46360747 TATAAACAGAAACAACAAAAAGG - Intergenic
1190576386 X:51843502-51843524 TGGAAACAGCCTCTAGAAAATGG + Intronic
1190739284 X:53278802-53278824 TATTAACAGCAGCAGCAAAAAGG - Intronic
1192040137 X:67611391-67611413 TAGTAACAGCAACAACAAATAGG - Intronic
1192628948 X:72760179-72760201 TAGCAACAACATCAACAAAAAGG - Intergenic
1192652762 X:72960635-72960657 TAGCAACAACATCAACAAAAAGG + Intergenic
1192737459 X:73862856-73862878 TAGAAATAGCACTTATAAAAAGG + Intergenic
1192858186 X:75036814-75036836 TAGTATCAGCATCAACAAAAAGG - Intergenic
1192974245 X:76266813-76266835 TAGCATCAGCATCAACAAAAAGG - Intergenic
1192992224 X:76472183-76472205 TAGCAACATCATCAACAAAAAGG + Intergenic
1193450189 X:81655864-81655886 TAGAAAAAGCAGGCAGAAAAAGG - Intergenic
1193510125 X:82389025-82389047 TAGCAACAACATCAACAAAAAGG + Intergenic
1194839258 X:98718457-98718479 TAGAAACAGAACCAATAAAATGG - Intergenic
1194902863 X:99535992-99536014 TAGAAACAGAGACTATAAAAAGG + Intergenic
1196046964 X:111266681-111266703 GAGAAGCAGTAGCTAGAAAATGG + Intronic
1196467173 X:115983934-115983956 TAGCATCAGCATCAACAAAAAGG + Intergenic
1197437045 X:126443103-126443125 TAGACACAACAGCAATAAAAAGG - Intergenic
1197558223 X:127983972-127983994 TAGAAACAGAAGATACAATGGGG - Intergenic
1197704759 X:129626672-129626694 TATAAACAGCAGCTAAATATTGG + Intergenic
1198164672 X:134042989-134043011 TATAGATAACAGCTACAAAATGG + Intergenic
1198213473 X:134535868-134535890 TAGAAGCAGTGACTACAAAAAGG - Intergenic
1198527237 X:137513883-137513905 TAGAAAAGGCACTTACAAAATGG + Intergenic
1198678859 X:139159405-139159427 AAGAAACAGCATCAACAAATGGG + Intronic
1199156836 X:144559647-144559669 TAGAAAGACAACCTACAAAATGG + Intergenic
1199436721 X:147820322-147820344 TAGCATCAGCATCAACAAAAGGG + Intergenic
1200294317 X:154902852-154902874 TCAAAACAGCAGCTATAAAGGGG + Intronic
1201185990 Y:11403226-11403248 AAGGAACAGCATCAACAAAAAGG + Intergenic
1201651716 Y:16295566-16295588 TAGAAACAACATCAACAAATAGG + Intergenic
1202166712 Y:21997045-21997067 AAAAAAAAGCAGCTACAAATTGG + Intergenic
1202224647 Y:22589328-22589350 AAAAAAAAGCAGCTACAAATTGG - Intergenic
1202318467 Y:23606332-23606354 AAAAAAAAGCAGCTACAAATTGG + Intergenic
1202552300 Y:26063725-26063747 AAAAAAAAGCAGCTACAAATTGG - Intergenic