ID: 998217238

View in Genome Browser
Species Human (GRCh38)
Location 5:140246465-140246487
Sequence TAGCCACTGCAGCTATAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998217228_998217238 30 Left 998217228 5:140246412-140246434 CCGTAACAGACTATCTCCTCTCA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 263
998217235_998217238 0 Left 998217235 5:140246442-140246464 CCATGGCCTGGGCCAGGCGTCTG 0: 1
1: 0
2: 4
3: 32
4: 333
Right 998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 263
998217231_998217238 14 Left 998217231 5:140246428-140246450 CCTCTCAAGGTTTTCCATGGCCT 0: 1
1: 1
2: 0
3: 15
4: 190
Right 998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 263
998217236_998217238 -6 Left 998217236 5:140246448-140246470 CCTGGGCCAGGCGTCTGTAGCCA 0: 1
1: 0
2: 1
3: 9
4: 177
Right 998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998217238 Original CRISPR TAGCCACTGCAGCTATAAAA TGG Intronic
900012250 1:125236-125258 TAACATCTCCAGCTATAAAATGG - Intergenic
900042309 1:481225-481247 TAACATCTCCAGCTATAAAATGG - Intergenic
900888787 1:5434084-5434106 TTATCACTGCAGCTATTAAAGGG - Intergenic
901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG + Intronic
904280641 1:29415960-29415982 GAGCCACTGCAGCTTTAAGAGGG + Intergenic
904421106 1:30393685-30393707 TAGACCATGCAGCTATTAAAAGG + Intergenic
904801265 1:33094423-33094445 TGGTCACTGCATCTGTAAAATGG + Intronic
905582224 1:39090902-39090924 TAGCCACAGCAACCAGAAAAAGG - Intronic
909269554 1:73605091-73605113 TACCCACTTCAGCAATAAATTGG - Intergenic
909388973 1:75095845-75095867 CTGCCAGTGCAGCTAGAAAAAGG + Intergenic
909497849 1:76299437-76299459 AAGTCACTGCAACTTTAAAAAGG + Intronic
909897480 1:81090400-81090422 TAGACACTGAAGAAATAAAAAGG - Intergenic
910009573 1:82444458-82444480 AACACAATGCAGCTATAAAAAGG - Intergenic
910150019 1:84131722-84131744 AAGCCACTGGAGCCATAAATTGG + Intronic
911038348 1:93572736-93572758 TAGTAACTACAGCTATAAACTGG - Intronic
912080355 1:105928857-105928879 TAGCAGATGCAGTTATAAAAGGG + Intergenic
914340082 1:146752870-146752892 CAGCCTCTGCATCCATAAAATGG - Intergenic
917366733 1:174239685-174239707 TAGCCACTGAAGCTACAGCAGGG - Intronic
917533363 1:175856434-175856456 TTGCCACCTTAGCTATAAAATGG + Intergenic
917638361 1:176958605-176958627 TAGTCATTGCACCCATAAAAAGG - Intronic
917941932 1:179931139-179931161 TAGTTTCTGCACCTATAAAATGG - Intergenic
921186432 1:212673879-212673901 TAGCCACTGCTTCTAAACAAAGG + Intergenic
921278096 1:213538968-213538990 AAGTCACTTCATCTATAAAATGG - Intergenic
922260679 1:223941709-223941731 TAACATCTCCAGCTATAAAATGG - Intergenic
922736392 1:227984025-227984047 TAACATCTCCAGCTATAAAATGG + Intergenic
923345835 1:233051693-233051715 TAGACATTGCAGGTAGAAAAGGG + Intronic
923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG + Intronic
924030068 1:239877594-239877616 CAGTCTCTGCATCTATAAAATGG - Intronic
924341854 1:243043898-243043920 TAACATCTCCAGCTATAAAATGG - Intergenic
1063470253 10:6278668-6278690 TATCCACTTTAGCTTTAAAATGG - Intergenic
1063731268 10:8699870-8699892 TAACCCCTACATCTATAAAATGG - Intergenic
1064507890 10:16053416-16053438 AATGCTCTGCAGCTATAAAAAGG - Intergenic
1064524730 10:16242840-16242862 AAGCCACTGGAGTTATAAACTGG + Intergenic
1064632361 10:17329436-17329458 TAGCCATTGCAGATATAACCAGG - Intronic
1065481982 10:26204591-26204613 TAGCCTCCTCATCTATAAAATGG - Intronic
1066734626 10:38461640-38461662 TAACATCTCCAGCTATAAAATGG + Intergenic
1067713432 10:48668419-48668441 GAGCCTCTGCATCTATAAATAGG - Intergenic
1069495880 10:68902821-68902843 TAGCCACTGAAACTAGATAACGG - Intronic
1070249331 10:74760271-74760293 AAGGCATTGCAGCCATAAAAAGG + Intergenic
1071143306 10:82538314-82538336 TAGAAACTGCAGCTAGAAATAGG - Intronic
1071879862 10:89885281-89885303 AAACTACTGCTGCTATAAAATGG - Intergenic
1075869580 10:125760175-125760197 TACCCACTGCTGTTAGAAAAAGG - Intronic
1076968582 11:117440-117462 TAACATCTCCAGCTATAAAATGG - Intergenic
1077965391 11:7126383-7126405 TAGACCCTGCAGACATAAAAAGG - Intergenic
1078764215 11:14277948-14277970 TAGCACCTGAAGCTATACAAGGG + Intronic
1079869112 11:25773711-25773733 TAGTTATTTCAGCTATAAAAGGG + Intergenic
1080956555 11:37103529-37103551 AAGCCACTGTAGCTATTAACTGG - Intergenic
1081302893 11:41475003-41475025 TAACCACTGCAGCTTTCTAATGG - Intergenic
1084750153 11:71199225-71199247 TAGCCCCTCCAACTGTAAAATGG + Intronic
1085707945 11:78803387-78803409 TACCCTTTGAAGCTATAAAATGG - Intronic
1086809743 11:91293913-91293935 TAGCCACTCCAGCTATTTTATGG - Intergenic
1087232945 11:95686461-95686483 TAACTATTGCACCTATAAAAGGG + Intergenic
1088155245 11:106795108-106795130 CAGCTTCTGCATCTATAAAATGG - Intronic
1088728782 11:112662443-112662465 TAGGCACTGCAGCTTTAGCAGGG - Intergenic
1089717987 11:120382732-120382754 TAACCAATGCACATATAAAAAGG - Intronic
1093426235 12:19032273-19032295 TAGCCACTACAAAGATAAAATGG + Intergenic
1093641798 12:21535606-21535628 TAGCTACTGCAGCAATAGGAGGG + Intronic
1093844608 12:23953913-23953935 TTTCCATTGCAGATATAAAAAGG + Intergenic
1096604389 12:52754275-52754297 AATCCACTGGACCTATAAAAGGG - Intergenic
1096939291 12:55324763-55324785 TATACACTGCAGCTGTAGAAGGG + Intergenic
1097858873 12:64498215-64498237 TAACCAGTGCTTCTATAAAATGG - Intronic
1097876258 12:64646950-64646972 TAGCTTCTTCATCTATAAAATGG - Intronic
1098170222 12:67739279-67739301 TAGTTTCTGCATCTATAAAATGG + Intergenic
1098509563 12:71295740-71295762 AAGCCACAGCATCTAGAAAATGG + Intronic
1100351162 12:93784364-93784386 CGGCCACCTCAGCTATAAAATGG - Intronic
1100605442 12:96148715-96148737 AAGCCTCTGTAGCTATAAAATGG + Intergenic
1101270992 12:103144366-103144388 TAGCCTCTGGAGCGATAAAGAGG - Intergenic
1103041193 12:117696831-117696853 CAGCCTCTGCACCTATAAAATGG + Intronic
1103779933 12:123391679-123391701 TCCCCACTGCAGCTTTGAAAGGG - Intronic
1104526554 12:129529383-129529405 AAGCCTCTGGAACTATAAAAAGG + Intronic
1106044615 13:26127232-26127254 CAGCTACTACATCTATAAAATGG + Intergenic
1106810755 13:33356573-33356595 CAGCCTCAGCATCTATAAAATGG + Intergenic
1107438267 13:40401361-40401383 TAGCATCTGCATCTATAAAATGG - Intergenic
1107795959 13:44052041-44052063 TAGCCATGGCAACTAGAAAAGGG - Intergenic
1108436659 13:50407290-50407312 TAGCCACTGCTCCTATAACTTGG + Intronic
1111633553 13:90874388-90874410 TTTCCACTTCAGATATAAAAAGG + Intergenic
1112400705 13:99075647-99075669 TAGCCACTGCACCCAGACAATGG + Intronic
1113202473 13:107882274-107882296 TAGCCACTGTAAATACAAAAAGG - Intergenic
1113412876 13:110105789-110105811 CACCCACTGCACCTCTAAAATGG - Intergenic
1115180231 14:30616682-30616704 TAGCCACTTAGGCTAAAAAAAGG + Exonic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115575607 14:34707866-34707888 TAGTTACTACATCTATAAAATGG - Exonic
1117636366 14:57748408-57748430 AACCCACTGTAGCTATAAAAGGG - Intronic
1117837697 14:59824705-59824727 TAGGTACTGCAGCCACAAAAAGG + Intronic
1118555808 14:67019801-67019823 TAGCTACTGCAGCATTGAAAGGG + Intronic
1124082365 15:26513196-26513218 AAGCCACTGGAGCCATAAACTGG - Intergenic
1124561133 15:30774381-30774403 TAGTTTCTGCAGTTATAAAATGG + Intergenic
1124669397 15:31624678-31624700 TAGTTTCTGCAGTTATAAAATGG - Intronic
1125648477 15:41293350-41293372 TATCAACTGCAACTATACAACGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1129410366 15:75347618-75347640 TCGCCACTGCAGCCACTAAAGGG - Intronic
1131967958 15:97865512-97865534 TAGCCAGTGCAGCTATGCAGTGG - Intergenic
1132282996 15:100636135-100636157 TAGTCACTGAAGCCATAAACTGG - Intronic
1132319763 15:100917703-100917725 CAGCCACTGCACCTTCAAAAAGG + Intergenic
1133985156 16:10662753-10662775 TAACCACTCCAGCTAGGAAATGG - Intronic
1136724243 16:32344840-32344862 GAGTCACTGCACCTATAAAAGGG - Intergenic
1137332569 16:47513686-47513708 TAGCCACTGGAGCTGTCAGAGGG + Intronic
1138327578 16:56188956-56188978 CAGCTTCTTCAGCTATAAAATGG + Intergenic
1139939899 16:70597723-70597745 TAGCCCCTGCATCTATTAAATGG + Intronic
1139994206 16:70964538-70964560 CAGCCTCTGCATCCATAAAATGG + Intronic
1140931467 16:79632160-79632182 TTGCCTCTGCAGACATAAAAAGG + Intergenic
1141504415 16:84465232-84465254 CAGCCACGGTAGCTATGAAAAGG + Intergenic
1141699865 16:85637465-85637487 TAGCCACTGCTGCAATCAAGGGG - Intronic
1141699872 16:85637500-85637522 TAGCCACTGCCGCGATCAAGGGG - Intronic
1142452096 16:90181680-90181702 TAACATCTCCAGCTATAAAATGG + Intergenic
1203002189 16_KI270728v1_random:172925-172947 GAGTCACTGCACCTATAAAAGGG + Intergenic
1203133792 16_KI270728v1_random:1709332-1709354 GAGTCACTGCACCTATAAAAGGG + Intergenic
1142973536 17:3629419-3629441 TAGCAACTGAACCCATAAAAAGG + Intronic
1143081719 17:4386447-4386469 TAGCCACTGCAGCTCAAAAGTGG - Intergenic
1144787240 17:17838673-17838695 CAGCTACTGTATCTATAAAATGG + Intergenic
1145976132 17:28985518-28985540 TTGCCTCCTCAGCTATAAAATGG + Intronic
1148190983 17:45678533-45678555 TAGCCACTGCATCTGGTAAAGGG - Intergenic
1150154373 17:62839202-62839224 TAGACACTGCAGACATCAAAAGG + Intergenic
1150735955 17:67739742-67739764 AAACCACTGCAGCTAGAAATGGG + Intronic
1151998275 17:77626888-77626910 TAGACCCTGCAGCTATCATAAGG - Intergenic
1156075408 18:33271452-33271474 TAGCCACTTCAGCTCTAACATGG - Intronic
1156811312 18:41255813-41255835 TAATCAATGCAGCTATAAGAAGG + Intergenic
1157314792 18:46578553-46578575 TTGCCACTGCAGCCTTCAAATGG + Intronic
1157422952 18:47561283-47561305 TAGCCTCTGCCGCTCTAAAGTGG - Intergenic
1157788997 18:50513809-50513831 TAGCCTCTTCAGCTGTAAAATGG - Intergenic
1157836481 18:50908525-50908547 CAGCCACTGAGGCTATAAAGTGG + Intronic
1159329365 18:66970202-66970224 AATACAATGCAGCTATAAAAAGG - Intergenic
1160645390 19:187366-187388 TAACATCTCCAGCTATAAAATGG - Intergenic
1161832472 19:6617184-6617206 TAGCACCTGAAGCTATACAAGGG - Intergenic
1162290572 19:9776962-9776984 TAAACCCTCCAGCTATAAAAAGG - Intronic
1163173589 19:15549541-15549563 GAGCCACTGCACCTGTAAACCGG - Intronic
1164282958 19:23785336-23785358 TAGCCCCAACACCTATAAAAAGG + Intronic
1164567707 19:29339680-29339702 CAGGCACTGCAGCTATAATTGGG - Intergenic
1165569036 19:36759624-36759646 TAACTACTGCAGCTAGGAAATGG + Intronic
1167193371 19:48007832-48007854 TAGTTTCTGCATCTATAAAATGG + Intronic
1168373874 19:55859431-55859453 GGGCCACTGCAGCCACAAAAGGG - Intronic
1168461792 19:56565845-56565867 AAGCCACTGGAGTTATAAACTGG - Intergenic
925469264 2:4141238-4141260 TAGTCACCGCATCTGTAAAACGG + Intergenic
927753644 2:25691503-25691525 TAGCCCCATCAGCTAGAAAAAGG + Intergenic
929498469 2:42468183-42468205 TAGTCACTGCAGCAAGACAAAGG + Intronic
931798152 2:65731764-65731786 TAGACATGGCAGCTAGAAAATGG - Intergenic
934634969 2:95976638-95976660 TAGCTTCTGCAGTTACAAAAGGG + Intronic
934798661 2:97128602-97128624 TAGCTTCTGCAGTTACAAAAGGG - Intronic
934834767 2:97574898-97574920 TAGCTTCTGCAGTTACAAAAGGG + Intronic
936012002 2:108930878-108930900 TGGCCTCTTCAGCTGTAAAATGG - Intronic
936996917 2:118425218-118425240 TTTCCACAACAGCTATAAAAAGG - Intergenic
937435846 2:121880450-121880472 AAGCCGCTGCAGCCATAAACTGG - Intergenic
937691997 2:124767149-124767171 GAGCCACTGCATCTGTTAAAAGG - Intronic
938565565 2:132515371-132515393 TATCCCCTGCAGCTAAAACAGGG + Intronic
940481820 2:154241866-154241888 TACTCACAGCAGTTATAAAAGGG + Intronic
940811660 2:158250022-158250044 TAGCCACTCCATTTAAAAAATGG + Intronic
940848335 2:158664187-158664209 GAGCCAGTGCAGCAATACAAAGG + Intronic
941992006 2:171566751-171566773 TAGCTTATGCATCTATAAAATGG + Intergenic
942309897 2:174646506-174646528 TAGCCACTGCAGCGCATAAACGG + Intronic
943433126 2:187828879-187828901 TAGCCAAGGCAGTTACAAAAAGG + Intergenic
943887569 2:193241351-193241373 AAGCCACTGAAGCCATAAAATGG - Intergenic
944708246 2:202312377-202312399 CAGTTTCTGCAGCTATAAAATGG + Intergenic
946553935 2:220833623-220833645 TGGCCTCTGTATCTATAAAAGGG + Intergenic
947579531 2:231305790-231305812 AAGCCACTGCAGCTGTATGATGG - Intronic
947780452 2:232756106-232756128 TTCCTACTGCATCTATAAAAAGG - Intronic
949083537 2:242126316-242126338 TAACATCTCCAGCTATAAAATGG + Intergenic
1169465876 20:5837650-5837672 GAGTCAGTGCAGCCATAAAAAGG - Intronic
1170020839 20:11835068-11835090 CAGCCTCTGCATCTCTAAAATGG - Intergenic
1171352864 20:24518166-24518188 TAGCTGCTGCAGCAAGAAAATGG + Intronic
1173428746 20:42967166-42967188 AACCCACTGCAGCTACCAAAGGG - Intronic
1173485780 20:43439990-43440012 GAGCCTCTTCATCTATAAAATGG - Intergenic
1174229319 20:49031545-49031567 TAGTTTCTTCAGCTATAAAATGG - Intronic
1174380487 20:50152883-50152905 TAGCCACTGAAGCTATCACTAGG + Intronic
1176017831 20:62945703-62945725 AAGCCACTGCCGCTATCACAGGG - Exonic
1176280118 20:64298857-64298879 TAACATCTCCAGCTATAAAATGG + Intergenic
1177784126 21:25651778-25651800 TAGGCACTGTAGCGATATAAAGG + Intronic
1178122328 21:29481792-29481814 GAGCAACTGCAGTTATAAAAAGG - Intronic
1178449301 21:32679998-32680020 TAGTCACTGCAGAAATGAAAAGG + Intronic
1178920577 21:36735788-36735810 CGGCCTCTGCAGCTATAATATGG - Intronic
1181138815 22:20788469-20788491 TTGCTTCTGCAGCTGTAAAAAGG - Intronic
1182342377 22:29633849-29633871 TAGACACTGATGCTACAAAATGG - Intronic
1183760125 22:39808744-39808766 TGGCCACTGCAGATAAAGAATGG + Intronic
949128150 3:470902-470924 TACCCACTGAAGCTATAATTGGG - Intergenic
949345062 3:3068827-3068849 TAGTAACTGCAACTATAAAATGG + Intronic
949661245 3:6281485-6281507 AAGCCACTGCAACTCTAAGATGG + Intergenic
949876246 3:8627895-8627917 TAGCCCCTTCATCTGTAAAATGG + Intronic
950152331 3:10697385-10697407 GAGCCTCAGCATCTATAAAATGG + Intronic
953430750 3:42837798-42837820 TAGGCAATACATCTATAAAAGGG + Intronic
956299327 3:67752924-67752946 GTGCCACTGAAGCCATAAAATGG + Intergenic
956301182 3:67774639-67774661 CATCCAATGCAGCTATAAAAGGG - Intergenic
956784244 3:72629169-72629191 CAGCTTCTGCATCTATAAAATGG - Intergenic
957547461 3:81658555-81658577 AAGCTTCTGCACCTATAAAAAGG + Intronic
957642841 3:82880503-82880525 TAGCAACTGCACCTACAACAGGG - Intergenic
959339815 3:105114629-105114651 TACACAATGCAGCCATAAAAAGG + Intergenic
960647592 3:119905611-119905633 TAGCAAGTTCAGCTATAAAGTGG - Intronic
961261293 3:125604286-125604308 TGGCCACTACAGCTTTAAAATGG + Intergenic
962305109 3:134279135-134279157 TAGCTCCTTCACCTATAAAATGG - Intergenic
964689832 3:159437967-159437989 CAGCTTCTCCAGCTATAAAATGG + Intronic
964879097 3:161403901-161403923 TTGACAATGAAGCTATAAAAGGG + Intergenic
964955340 3:162348504-162348526 TAAACACTTCATCTATAAAAAGG - Intergenic
968254596 3:197255877-197255899 TAGTGATTGCAGTTATAAAAAGG + Intronic
968372293 3:198232160-198232182 TAACATCTCCAGCTATAAAATGG + Intergenic
968381779 4:102641-102663 CAGCCTCTTCTGCTATAAAATGG + Intergenic
969937185 4:10693909-10693931 TGGCCACTGGAGCTGCAAAATGG - Intergenic
969942374 4:10747125-10747147 TGGCCACTGAAGGTATAAAGAGG + Intergenic
970678362 4:18477995-18478017 TAGCCACAACAGCTTTGAAAAGG + Intergenic
971002592 4:22339321-22339343 CAGACCCTGCAGCTAAAAAATGG + Intergenic
971505260 4:27359351-27359373 AAGCCACTGGAGCTAGAAATGGG + Intergenic
971823161 4:31585876-31585898 TAGCCTCTTCATTTATAAAATGG + Intergenic
974088390 4:57285103-57285125 CAGTCTCTGCATCTATAAAATGG - Intergenic
974235436 4:59174838-59174860 TAGCCATTGCTGATATCAAAAGG - Intergenic
975640889 4:76499232-76499254 TAGCCACAGCAGCTAGGAAGTGG - Intronic
975680827 4:76874239-76874261 CAGCCACTGCAGTTTTAAAAGGG - Intergenic
978086433 4:104661404-104661426 TTGCCTCTGTAGATATAAAATGG - Intergenic
979260980 4:118644621-118644643 TAACATCTCCAGCTATAAAATGG + Intergenic
979306027 4:119144545-119144567 TAGCTGCTGAAGATATAAAATGG - Intronic
979429853 4:120616199-120616221 TAGTCACTGTAGGTATAAAGAGG - Intergenic
980843065 4:138290187-138290209 TACCCACTGAATCTATAATACGG - Intergenic
983290413 4:165796952-165796974 TAGCTAGTGCAACTAAAAAATGG - Intergenic
983338973 4:166433537-166433559 TATCCCCTGCAGATATGAAAAGG - Intergenic
984287306 4:177747853-177747875 AAGCCACTGCAGCTATGTAACGG - Intronic
986787481 5:11127644-11127666 TAGACACTCCAGTTCTAAAAGGG - Intronic
987196487 5:15531972-15531994 TAGTATCTTCAGCTATAAAATGG + Intronic
987212382 5:15695887-15695909 AAGCAACTGCAGCTAGAAACAGG - Intronic
989399795 5:40996728-40996750 TAGCCACTGGAACTACAACAGGG - Intergenic
989715849 5:44462025-44462047 TAGCCACTGCAGCTTTCTTATGG + Intergenic
992027664 5:72686591-72686613 CAGCCTCTCCATCTATAAAAGGG + Intergenic
994383650 5:99102118-99102140 TAGTCTCTGCAGCCATAAAATGG + Intergenic
994606231 5:101970749-101970771 AAGCCACTGAAGCCATAAACTGG + Intergenic
994628633 5:102253465-102253487 TAGACACTGCAGATACAAGAGGG + Intronic
994964418 5:106650361-106650383 TAGCCACTAGTGGTATAAAAAGG - Intergenic
995178537 5:109207810-109207832 TTGCCAGTGCAGATACAAAACGG + Intergenic
995797860 5:115961280-115961302 TTTCCATAGCAGCTATAAAACGG - Intergenic
997380695 5:133434715-133434737 TAGCCAATGAAAATATAAAATGG - Intronic
997888009 5:137648687-137648709 TAGCCTCTGCAGCTATCTCAAGG + Intronic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
998795438 5:145813213-145813235 TAGCCACTGCACCCAGAATAGGG - Intronic
1000179638 5:158795631-158795653 TTGCCACGGCATCTATATAACGG + Intronic
1001784624 5:174401466-174401488 TAGCCTATGCAGCTATTAAGAGG + Intergenic
1002731534 5:181337704-181337726 TAACATCTCCAGCTATAAAATGG + Intergenic
1002753003 6:136388-136410 TAACATCTCCAGCTATAAAATGG - Intergenic
1004105026 6:12659592-12659614 TTTCCACTGCAGCCAAAAAAAGG - Intergenic
1004260789 6:14105960-14105982 AGGACACTGCAGCCATAAAAAGG + Intergenic
1004807035 6:19213933-19213955 AAGCCACTGCAGCCATAAACTGG - Intergenic
1005236500 6:23768099-23768121 TGGACACAGCAGCTCTAAAAAGG - Intergenic
1010783937 6:79978086-79978108 GAGACACTGCCTCTATAAAAGGG - Intergenic
1012056586 6:94420047-94420069 TAAGACCTGCAGCTATAAAACGG - Intergenic
1012664940 6:101956544-101956566 TAGACACCGGAGCTATGAAAAGG - Intronic
1014947225 6:127513800-127513822 TAGCTTCTGCACCTATAAAATGG + Intronic
1015161344 6:130155428-130155450 ATGGTACTGCAGCTATAAAAAGG - Intronic
1016377870 6:143442369-143442391 TAGAAGCTGCAGCTATAAAGAGG + Intronic
1016512788 6:144862485-144862507 TAGCCACAGCAGCTAAACTAGGG - Intergenic
1017241495 6:152174743-152174765 TAGCCCCTGTATCTGTAAAATGG + Intronic
1018501684 6:164417873-164417895 ATGCCACTTCAGCTATAGAATGG - Intergenic
1021892883 7:25204085-25204107 GAGCCACTGGAGCTATAAACTGG - Intergenic
1022789842 7:33676053-33676075 TTCCCACTCCATCTATAAAATGG + Intergenic
1024111471 7:46151349-46151371 TAGCCACTGTTGCTAAAGAATGG - Intergenic
1024468717 7:49742991-49743013 GACCCACTGCAGCTATGAAAAGG + Intergenic
1028216117 7:88135420-88135442 TAGTCACTTCATCTGTAAAATGG - Intronic
1028350250 7:89838143-89838165 TAGATTCTGCAGCTTTAAAATGG + Intergenic
1028576593 7:92358775-92358797 TAGTTACTGCAGATATATAAGGG + Intronic
1029180147 7:98694647-98694669 TAGCTACTGCAACCATAAGAGGG + Intergenic
1029548680 7:101224731-101224753 TAGCAACTGGAGAAATAAAAAGG - Intergenic
1030235469 7:107255699-107255721 TAGTTTCTGCATCTATAAAATGG - Intronic
1031457778 7:122004940-122004962 TATGCACTACAGCTATAAACTGG + Intronic
1032971273 7:137166665-137166687 TAGCCACTGAAGCTATTCAAAGG - Intergenic
1033029087 7:137807647-137807669 AAGCCACTGCAGCTATTGATAGG + Intronic
1033720014 7:144049370-144049392 TAGCCACAGGGGCTATAGAAAGG - Intergenic
1033955710 7:146844887-146844909 TTACCACTGCATCTATTAAATGG + Intronic
1035511980 8:196573-196595 TAACATCTCCAGCTATAAAATGG - Intronic
1038980394 8:32753052-32753074 GTGCCACTGCAGATATAATATGG + Intronic
1039902711 8:41764914-41764936 TGGTCACTTCATCTATAAAAAGG - Intronic
1040742600 8:50597253-50597275 TATTCTCTGCAGCTATACAAGGG - Intronic
1041959536 8:63597031-63597053 TAGCTACTGATGCTATTAAATGG + Intergenic
1043630664 8:82327620-82327642 TAGTCACTACAGCGATGAAACGG + Intergenic
1047017015 8:120734580-120734602 TATCCTCTTCATCTATAAAATGG - Intronic
1050977816 9:11964508-11964530 AAGACACTGGAGTTATAAAATGG - Intergenic
1051189169 9:14492805-14492827 TAGCCTCTTTACCTATAAAAGGG - Intergenic
1055026096 9:71723311-71723333 AAAACACTGTAGCTATAAAATGG + Intronic
1055634914 9:78267529-78267551 TAGACACCTCATCTATAAAATGG - Intronic
1055976972 9:81965126-81965148 AAGCCACTGAAGCCATAAACTGG - Intergenic
1059580390 9:115540885-115540907 TAACAACTGCAGTTATTAAAGGG + Intergenic
1059965387 9:119608719-119608741 TAGCTTCTTCATCTATAAAATGG + Intergenic
1062755939 9:138290214-138290236 TAACATCTCCAGCTATAAAATGG + Intergenic
1185778619 X:2826393-2826415 TAGACACTGGAGATACAAAAGGG + Intergenic
1187036820 X:15549311-15549333 GAACCACTGCAGCAATAGAAAGG + Intronic
1189124756 X:38434591-38434613 TAGCCTCTTCATTTATAAAAAGG - Intronic
1189732963 X:44040779-44040801 TTGCAACTGAAGCTATAAAAGGG + Intergenic
1190301112 X:49058147-49058169 CAGCTTCTGCATCTATAAAATGG + Intronic
1190734545 X:53247392-53247414 TAGTCACTTCATCTGTAAAATGG - Intronic
1193841134 X:86409745-86409767 TAGCCAATGCAGATATACAAAGG + Intronic
1193968457 X:88020006-88020028 AAGCCACTGAAGCCATAAATGGG + Intergenic
1196039166 X:111183312-111183334 TTGCTGCTGCTGCTATAAAAAGG - Intronic
1196191603 X:112800869-112800891 TAGCCACTGCAGTTCAGAAAAGG + Intronic
1197437045 X:126443103-126443125 TAGACACAACAGCAATAAAAAGG - Intergenic
1197900220 X:131363588-131363610 TAGCTAGTTCATCTATAAAATGG + Intronic
1198003134 X:132461045-132461067 GAGTCATTGCAGCCATAAAAAGG - Intronic
1200274518 X:154718994-154719016 TAGACAATGAAGCTAGAAAAGGG + Intronic
1202382446 Y:24287032-24287054 TAACATCTCCAGCTATAAAATGG + Intergenic
1202488338 Y:25383093-25383115 TAACATCTCCAGCTATAAAATGG - Intergenic