ID: 998223896

View in Genome Browser
Species Human (GRCh38)
Location 5:140311267-140311289
Sequence ACCAGGACATTTATTATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998223891_998223896 15 Left 998223891 5:140311229-140311251 CCCAAACAGAATTGTGGCCACTC No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223887_998223896 24 Left 998223887 5:140311220-140311242 CCCCATTGACCCAAACAGAATTG No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223892_998223896 14 Left 998223892 5:140311230-140311252 CCAAACAGAATTGTGGCCACTCC No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223893_998223896 -2 Left 998223893 5:140311246-140311268 CCACTCCTGATTGCGAGAGATAC No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223889_998223896 22 Left 998223889 5:140311222-140311244 CCATTGACCCAAACAGAATTGTG No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223895_998223896 -7 Left 998223895 5:140311251-140311273 CCTGATTGCGAGAGATACCAGGA No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data
998223888_998223896 23 Left 998223888 5:140311221-140311243 CCCATTGACCCAAACAGAATTGT No data
Right 998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998223896 Original CRISPR ACCAGGACATTTATTATTAC AGG Intergenic
No off target data available for this crispr