ID: 998224758

View in Genome Browser
Species Human (GRCh38)
Location 5:140318379-140318401
Sequence TCTCTTTGCTGAAGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224758_998224765 12 Left 998224758 5:140318379-140318401 CCCCACCCCCTTCAGCAAAGAGA No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224758_998224768 25 Left 998224758 5:140318379-140318401 CCCCACCCCCTTCAGCAAAGAGA No data
Right 998224768 5:140318427-140318449 AGAAAAGAGGTCTCTGCATGGGG No data
998224758_998224767 24 Left 998224758 5:140318379-140318401 CCCCACCCCCTTCAGCAAAGAGA No data
Right 998224767 5:140318426-140318448 AAGAAAAGAGGTCTCTGCATGGG No data
998224758_998224766 23 Left 998224758 5:140318379-140318401 CCCCACCCCCTTCAGCAAAGAGA No data
Right 998224766 5:140318425-140318447 AAAGAAAAGAGGTCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224758 Original CRISPR TCTCTTTGCTGAAGGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr