ID: 998224759

View in Genome Browser
Species Human (GRCh38)
Location 5:140318380-140318402
Sequence CTCTCTTTGCTGAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224759_998224769 30 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224759_998224767 23 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224767 5:140318426-140318448 AAGAAAAGAGGTCTCTGCATGGG No data
998224759_998224765 11 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224759_998224768 24 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224768 5:140318427-140318449 AGAAAAGAGGTCTCTGCATGGGG No data
998224759_998224766 22 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224766 5:140318425-140318447 AAAGAAAAGAGGTCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224759 Original CRISPR CTCTCTTTGCTGAAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr