ID: 998224762

View in Genome Browser
Species Human (GRCh38)
Location 5:140318385-140318407
Sequence TGATACTCTCTTTGCTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224762_998224767 18 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224767 5:140318426-140318448 AAGAAAAGAGGTCTCTGCATGGG No data
998224762_998224766 17 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224766 5:140318425-140318447 AAAGAAAAGAGGTCTCTGCATGG No data
998224762_998224770 26 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG No data
998224762_998224765 6 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224762_998224769 25 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224762_998224768 19 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224768 5:140318427-140318449 AGAAAAGAGGTCTCTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224762 Original CRISPR TGATACTCTCTTTGCTGAAG GGG (reversed) Intergenic
No off target data available for this crispr