ID: 998224764

View in Genome Browser
Species Human (GRCh38)
Location 5:140318387-140318409
Sequence ACTGATACTCTCTTTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224764_998224770 24 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG No data
998224764_998224769 23 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224764_998224766 15 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224766 5:140318425-140318447 AAAGAAAAGAGGTCTCTGCATGG No data
998224764_998224768 17 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224768 5:140318427-140318449 AGAAAAGAGGTCTCTGCATGGGG No data
998224764_998224765 4 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224764_998224767 16 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224767 5:140318426-140318448 AAGAAAAGAGGTCTCTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224764 Original CRISPR ACTGATACTCTCTTTGCTGA AGG (reversed) Intergenic
No off target data available for this crispr