ID: 998224765

View in Genome Browser
Species Human (GRCh38)
Location 5:140318414-140318436
Sequence GTTTTGCTAAAAAAGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224764_998224765 4 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224763_998224765 5 Left 998224763 5:140318386-140318408 CCCTTCAGCAAAGAGAGTATCAG No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224762_998224765 6 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224761_998224765 7 Left 998224761 5:140318384-140318406 CCCCCTTCAGCAAAGAGAGTATC No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224759_998224765 11 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224760_998224765 10 Left 998224760 5:140318381-140318403 CCACCCCCTTCAGCAAAGAGAGT No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data
998224758_998224765 12 Left 998224758 5:140318379-140318401 CCCCACCCCCTTCAGCAAAGAGA No data
Right 998224765 5:140318414-140318436 GTTTTGCTAAAAAAGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224765 Original CRISPR GTTTTGCTAAAAAAGAAAAG AGG Intergenic
No off target data available for this crispr