ID: 998224769

View in Genome Browser
Species Human (GRCh38)
Location 5:140318433-140318455
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224762_998224769 25 Left 998224762 5:140318385-140318407 CCCCTTCAGCAAAGAGAGTATCA No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224759_998224769 30 Left 998224759 5:140318380-140318402 CCCACCCCCTTCAGCAAAGAGAG No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224761_998224769 26 Left 998224761 5:140318384-140318406 CCCCCTTCAGCAAAGAGAGTATC No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224760_998224769 29 Left 998224760 5:140318381-140318403 CCACCCCCTTCAGCAAAGAGAGT No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224764_998224769 23 Left 998224764 5:140318387-140318409 CCTTCAGCAAAGAGAGTATCAGT No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data
998224763_998224769 24 Left 998224763 5:140318386-140318408 CCCTTCAGCAAAGAGAGTATCAG No data
Right 998224769 5:140318433-140318455 GAGGTCTCTGCATGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr