ID: 998224913

View in Genome Browser
Species Human (GRCh38)
Location 5:140319473-140319495
Sequence CAGAGTTCCTACTATGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998224911_998224913 3 Left 998224911 5:140319447-140319469 CCATTCATTTATCTGACAATTCT No data
Right 998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG No data
998224910_998224913 14 Left 998224910 5:140319436-140319458 CCTTCATTCAACCATTCATTTAT No data
Right 998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG No data
998224908_998224913 23 Left 998224908 5:140319427-140319449 CCCAAAGGGCCTTCATTCAACCA No data
Right 998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG No data
998224909_998224913 22 Left 998224909 5:140319428-140319450 CCAAAGGGCCTTCATTCAACCAT No data
Right 998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998224913 Original CRISPR CAGAGTTCCTACTATGTGCT AGG Intergenic
No off target data available for this crispr