ID: 998228786

View in Genome Browser
Species Human (GRCh38)
Location 5:140346247-140346269
Sequence CGACGCCCCCGGAGATCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998228786_998228797 24 Left 998228786 5:140346247-140346269 CCCCCCGATCTCCGGGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 998228797 5:140346294-140346316 AAGAGCTTCAGCACCACCGACGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998228786 Original CRISPR CGACGCCCCCGGAGATCGGG GGG (reversed) Intronic
923569932 1:235104304-235104326 CGAGGCTCCCGGAGGCCGGGGGG + Intergenic
1080515549 11:33016181-33016203 CAACGCCCCCGCCGAGCGGGCGG + Intronic
1080941278 11:36921428-36921450 AGACACCCCCGGAGAGAGGGGGG - Intergenic
1084749308 11:71193734-71193756 CCACGCCCCCGGAGGCCAGGAGG + Intronic
1088172805 11:107017741-107017763 CGGCGCCCTCGGTGAGCGGGGGG - Exonic
1103901762 12:124307107-124307129 CGATGCCCCCGCGGATGGGGAGG - Intronic
1115028177 14:28766582-28766604 CGAGGCCCGCGGAGAGGGGGAGG + Intergenic
1115850054 14:37583963-37583985 CGACGCCCCCTGGGCTCGGGGGG - Intergenic
1120834435 14:89027365-89027387 CGACTTCCCCGGAGCTAGGGCGG - Intergenic
1122399240 14:101457715-101457737 CGACGCGCCTGGAGCCCGGGAGG + Intergenic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1127094387 15:55498166-55498188 CCACACCCCCGGAGACCGGCAGG + Intronic
1129659110 15:77543208-77543230 GGACGCCCCCGGAGATGAGGAGG - Intergenic
1137300352 16:47143384-47143406 CGGCGCGCCCGGAGAGCCGGCGG + Intronic
1142859952 17:2755522-2755544 CGCCGGCCCCGCAGAACGGGCGG - Intergenic
1147667115 17:42155753-42155775 AGACGCCCCTGGCAATCGGGCGG - Intergenic
1148909236 17:50931676-50931698 GGACCCGCCCGGAGCTCGGGAGG + Intergenic
1157095115 18:44680233-44680255 CGGCGCCCCCCGAGCTAGGGCGG + Intronic
1161113000 19:2480035-2480057 CTATGCCCCCGGGGATCGGATGG + Intergenic
1161866615 19:6837126-6837148 AGACACCCCCGGAGTTGGGGAGG + Intronic
1166169157 19:41015225-41015247 AGACGGCCCCAGAGATGGGGAGG + Intronic
1167471358 19:49677841-49677863 AGATGCCCCCGGAGCTCGGAAGG - Intronic
1168538520 19:57191699-57191721 CGCCGCCCCTGGAGACCGCGGGG - Exonic
932239023 2:70142631-70142653 CGGCCCGCCCGGGGATCGGGAGG - Intergenic
1183453003 22:37906698-37906720 CGACGGCCCCGGACGCCGGGCGG + Intronic
950533402 3:13566165-13566187 AGAAGCCCCTGGAGATGGGGTGG - Intronic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
998228786 5:140346247-140346269 CGACGCCCCCGGAGATCGGGGGG - Intronic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1006366826 6:33621127-33621149 GGACGCCTCTGGAGATCAGGAGG + Exonic
1019783517 7:2958865-2958887 TGACACCCCTGGAGATGGGGAGG + Intronic
1036822803 8:11953690-11953712 CGACACCTCCGCAGATTGGGAGG - Intergenic
1039554754 8:38467948-38467970 CGGCGCCCCCGGATCTGGGGCGG - Intronic
1062041742 9:134407578-134407600 GGACACCCCCGGGCATCGGGTGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic