ID: 998228786

View in Genome Browser
Species Human (GRCh38)
Location 5:140346247-140346269
Sequence CGACGCCCCCGGAGATCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998228786_998228797 24 Left 998228786 5:140346247-140346269 CCCCCCGATCTCCGGGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 998228797 5:140346294-140346316 AAGAGCTTCAGCACCACCGACGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998228786 Original CRISPR CGACGCCCCCGGAGATCGGG GGG (reversed) Intronic