ID: 998229103

View in Genome Browser
Species Human (GRCh38)
Location 5:140348159-140348181
Sequence TCCTTTTGGGTGATGAGTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998229098_998229103 14 Left 998229098 5:140348122-140348144 CCTGTCACCTATTTGGCTAAGAG No data
Right 998229103 5:140348159-140348181 TCCTTTTGGGTGATGAGTATCGG No data
998229100_998229103 -9 Left 998229100 5:140348145-140348167 CCACTGTTAGATTATCCTTTTGG No data
Right 998229103 5:140348159-140348181 TCCTTTTGGGTGATGAGTATCGG No data
998229099_998229103 7 Left 998229099 5:140348129-140348151 CCTATTTGGCTAAGAGCCACTGT No data
Right 998229103 5:140348159-140348181 TCCTTTTGGGTGATGAGTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998229103 Original CRISPR TCCTTTTGGGTGATGAGTAT CGG Intergenic
No off target data available for this crispr