ID: 998232399

View in Genome Browser
Species Human (GRCh38)
Location 5:140369188-140369210
Sequence TGGTGTGTGCCTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998232399 Original CRISPR TGGTGTGTGCCTAAGGTGGA AGG Intronic
901234225 1:7659013-7659035 TGGTGGGTCACTAAGGGGGATGG - Intronic
902589511 1:17463518-17463540 AGATGTGTGCCCAAGGTGGCTGG + Intergenic
903117556 1:21190694-21190716 TGGCATGTGCCCAAGGTGGTAGG - Intergenic
903407658 1:23111768-23111790 TGTTGTGTGTGTAAGGTGGGTGG - Intronic
904175163 1:28622643-28622665 TGTTGGGTGCCTGAAGTGGAAGG + Intronic
904193117 1:28763159-28763181 TGAGGAGGGCCTAAGGTGGATGG + Intronic
904574967 1:31499629-31499651 TGACATGTGCCTAAGGTGGTCGG - Intergenic
905913041 1:41666884-41666906 TGGTGGGAGCATAGGGTGGATGG - Intronic
907541051 1:55215518-55215540 CGGAGCGTGCCTAAGGTGAAAGG + Intergenic
908759020 1:67494982-67495004 TGGATTGTGGTTAAGGTGGAAGG + Intergenic
910544175 1:88395521-88395543 TGGTGTGTGGGGAAGGCGGAAGG + Intergenic
914815720 1:151060513-151060535 TGGCGTGTTCCAAAGATGGAGGG - Exonic
915167078 1:153953980-153954002 GGGTGTGTGTGTAAGGGGGAGGG - Intronic
916801317 1:168219241-168219263 TGGCATGTGCCCAAGGTGGCTGG + Intergenic
918287477 1:183071798-183071820 AGGTGTGTGCCTTAGGGAGAAGG + Intronic
920150537 1:203902771-203902793 TGGTGTTTGCCAAAGGGTGAAGG - Intergenic
922403305 1:225284079-225284101 TGGTATTTTCCTAAGGTGGAAGG - Intronic
922570612 1:226632694-226632716 TGGTGTCTGCCTAAAGTGCTTGG + Exonic
924708933 1:246518766-246518788 GGGTGTGTGGCTCAGGTGCAGGG - Intergenic
1062856738 10:783627-783649 TGCTGTGTGCTGAAGCTGGAAGG + Intergenic
1063797464 10:9528816-9528838 TGGTGTCTTCCTAAGTTGGAAGG + Intergenic
1065941287 10:30566212-30566234 TTGTGGTTGCCTAAGGTTGAGGG - Intergenic
1067087494 10:43250623-43250645 TGGGGTGTGCCGAAGGGGAAGGG + Intronic
1069059078 10:63874756-63874778 TGGTGGTTGCCTAAGGCTGAGGG + Intergenic
1069679674 10:70275012-70275034 TGGTGGGTGCCTGGGATGGAGGG - Intronic
1073483769 10:103803819-103803841 TGACATGTGCCCAAGGTGGATGG + Intronic
1074135066 10:110618890-110618912 TGGTGGTTGCCTAAGTGGGATGG + Intergenic
1074177942 10:111029975-111029997 TGGGGAGGACCTAAGGTGGATGG + Intergenic
1076028229 10:127134864-127134886 TGGTGTTTGCCTCACCTGGACGG - Intronic
1076288726 10:129327133-129327155 TGTGGTGTGTGTAAGGTGGAAGG + Intergenic
1077324892 11:1959427-1959449 GTGTGTGTGCCTGAGGTGGTGGG - Intronic
1082151122 11:48739861-48739883 TGGTGTGGGGGTAGGGTGGAGGG + Intergenic
1083181304 11:60987576-60987598 TGGTGTGTGTGTATGGTGGGGGG + Intronic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1090396775 11:126424377-126424399 TGCTGTGTGCCAGAGGTGGGCGG - Exonic
1202807874 11_KI270721v1_random:14606-14628 GTGTGTGTGCCTGAGGTGGTGGG - Intergenic
1092156779 12:6287683-6287705 TGGTGTGCACCTGAGGTGGGAGG + Intergenic
1093066498 12:14663758-14663780 TGCTGGGTGCCAAAGGTGTAAGG - Intronic
1096707341 12:53430485-53430507 AGGTGTGTGTCTCAGGTAGATGG - Intronic
1097476798 12:60067729-60067751 TTGTGTATGCCTCAGTTGGAAGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1102483985 12:113243841-113243863 TTGTGTGTTCCTCATGTGGACGG + Intronic
1103335082 12:120183418-120183440 AGGTGTGTGGCTTTGGTGGATGG - Intronic
1103627341 12:122230033-122230055 TGATGACTGCCTGAGGTGGAAGG + Exonic
1104048663 12:125182139-125182161 TGGTGGGTGCTAAGGGTGGAAGG + Intergenic
1104416705 12:128601673-128601695 TGGAGTCGTCCTAAGGTGGAAGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1110319017 13:74138881-74138903 AGGTGTGTGCCCAGGCTGGAGGG - Intergenic
1110869676 13:80435669-80435691 TGACATGTGCCCAAGGTGGATGG - Intergenic
1111012026 13:82325952-82325974 AGGTGTTTGCCTCACGTGGAGGG + Intergenic
1112157708 13:96835450-96835472 TGATTTGTTCCTAAGGTAGAAGG + Exonic
1113396676 13:109954528-109954550 TGCTGTGAGCCTCAGGGGGAAGG + Intergenic
1113416993 13:110136411-110136433 TGGTGTGTGCCCAAGGTGGCTGG + Intergenic
1113732611 13:112652697-112652719 TGGCATGTGCCCAAGGTGGTTGG + Intronic
1114940711 14:27606957-27606979 TGGTATGTGCCCAAGGTGGTTGG - Intergenic
1117322347 14:54636140-54636162 TGGTGTGAGCCTCAGCTAGAAGG + Intronic
1117323321 14:54645031-54645053 TGATGTGTACCAAAGGTTGATGG + Intronic
1117701549 14:58419083-58419105 TGCTGTGTGCCACTGGTGGAGGG + Intronic
1120229534 14:81827900-81827922 TGGTGAGTGCTGAAGGGGGATGG + Intergenic
1120966420 14:90171545-90171567 CGGCATGTGCCTAAGGTGGCTGG + Intronic
1125675075 15:41497565-41497587 AGGTATCTCCCTAAGGTGGAAGG + Intronic
1126707143 15:51416102-51416124 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1127180813 15:56415402-56415424 TGGTCTTTGTATAAGGTGGAAGG + Intronic
1127354855 15:58188450-58188472 TGCTGGGAGCCTGAGGTGGAGGG - Intronic
1127674507 15:61227561-61227583 GGGGGTGTGGCTAAGGTGGGGGG + Intronic
1127832484 15:62763309-62763331 TGGTATCAGCCTAAGGTGGAGGG + Intronic
1128220206 15:65963750-65963772 TGGTGTGAGGCAGAGGTGGAAGG - Intronic
1128521612 15:68378793-68378815 AGGTGTGTGCCCAAGCTGAAAGG - Intronic
1130061327 15:80572248-80572270 TGGTGTGTGGCCACCGTGGAAGG - Intronic
1130934276 15:88455479-88455501 TGCTGAGTGGCTAAGGTGGGTGG - Intergenic
1132279995 15:100603967-100603989 TTGTGTGTGACAAATGTGGATGG + Intronic
1132584049 16:698444-698466 TGGTGGGTACCTACAGTGGACGG - Intronic
1136400791 16:30017025-30017047 AGGTGTGTGCCAAAGCTGGGAGG + Intronic
1139027365 16:62834734-62834756 AACTGTGTGCCTAAGATGGAAGG + Intergenic
1140249876 16:73286745-73286767 TGGTGTGTGGCTAAGTGGGTTGG + Intergenic
1142056749 16:88002425-88002447 GGGTCTGTGCCCTAGGTGGATGG + Intronic
1144769800 17:17753135-17753157 TGGTGTGTGCCCTTGGTGAATGG + Intronic
1144954055 17:19010313-19010335 TGGTGTGGGCCTTGGCTGGACGG + Intronic
1150058773 17:62045487-62045509 TGCTCTGTGCCCAAGATGGATGG - Intronic
1150079590 17:62224994-62225016 TGTGGTGTGGCTAATGTGGAAGG + Intergenic
1150484759 17:65536241-65536263 TGGTCTGTGGCTAATGGGGAGGG - Intronic
1151536126 17:74739772-74739794 TTTTGGGTGCCCAAGGTGGACGG - Intronic
1151599409 17:75097171-75097193 TTGTGTGTGTCTGCGGTGGAGGG - Intronic
1152394104 17:80021657-80021679 TGGTGTGTGCCTATGGTATGTGG - Intronic
1152394584 17:80024474-80024496 TGGTGTGTGTCTATGGTGTGTGG - Intronic
1157191143 18:45582832-45582854 TGGAGTGTTCCTAAGGGGGGTGG - Intronic
1158407989 18:57177542-57177564 TGTTCTGTGGCTAAGCTGGAGGG + Intergenic
1158570195 18:58591625-58591647 TGGTGTGTGCCTGTGGTTGGTGG + Intronic
1160177948 18:76611553-76611575 GCGTGTGTGCCTGCGGTGGAGGG + Intergenic
1160177982 18:76611796-76611818 GCGTGTGTGCCTGCGGTGGAGGG + Intergenic
1160177991 18:76611859-76611881 GCGTGTGTGCCTGCGGTGGAGGG + Intergenic
1160178001 18:76611918-76611940 GCGTGTGTGCCTGCGGTGGAGGG + Intergenic
1160178011 18:76611983-76612005 GCGTGTGTGCCTGCGGTGGAGGG + Intergenic
1161293467 19:3507638-3507660 TGGTGTGTGTCCTTGGTGGATGG - Intronic
1163415761 19:17185660-17185682 TTGTTTTTGCCTCAGGTGGAAGG - Intronic
1167351194 19:48975792-48975814 TGGTGGGTGCCTCAGGAGGCTGG + Intronic
1167485471 19:49760467-49760489 TGGTGTGTGCCTGTGGTGGTGGG - Intronic
1167922480 19:52793249-52793271 TGACATGTGCCCAAGGTGGACGG - Intronic
1168136735 19:54356875-54356897 TGGTGTGTGCCTCTTGGGGAAGG - Intronic
925140696 2:1548051-1548073 TGGTGTGTGTGTATGGTGGGTGG - Intergenic
925240697 2:2324311-2324333 GGGTGAGTCCCTAAGATGGAAGG - Intronic
925812399 2:7713175-7713197 TGGTGTCTGGCCATGGTGGATGG - Intergenic
926348385 2:11970807-11970829 TGATATGTGCCCAAGGTGGCTGG - Intergenic
926473206 2:13287829-13287851 TGGTATGTGCATAAGTTTGAAGG - Intergenic
932067459 2:68580819-68580841 TGGTGTGTGCATGTGGGGGAGGG + Intronic
932217001 2:69972914-69972936 TGGAGGGGGCCTCAGGTGGAAGG - Intergenic
933245164 2:79966849-79966871 AGGTGTGTGTCTCAGGAGGAAGG - Intronic
933520223 2:83362516-83362538 TGTTGGGAGGCTAAGGTGGAAGG + Intergenic
937630296 2:124094123-124094145 TGGTGTGTGAATAAAGGGGATGG + Intronic
940004688 2:148999710-148999732 TGGTGAGTGAGTTAGGTGGAGGG + Intronic
942422761 2:175825024-175825046 TGCTGTGTTCCTGAGGTGAATGG - Intergenic
944797566 2:203203595-203203617 TGGTGGGAGGCTGAGGTGGAAGG + Intronic
947211841 2:227715815-227715837 TGGTGTGTGCCTATAGTGCCAGG + Intronic
948221254 2:236271504-236271526 TGATATGTGCCCAAGGTGGTCGG - Intergenic
948506076 2:238427567-238427589 TGGTCTGTGCCTGTGGTGGGTGG - Intronic
1168973859 20:1949569-1949591 GGGTCTGTGCCAGAGGTGGAGGG - Intergenic
1169023052 20:2344458-2344480 TTTTGGCTGCCTAAGGTGGAAGG - Intergenic
1170064719 20:12298944-12298966 TGGTGTGTGCCTCAGGTAGGAGG + Intergenic
1171274169 20:23841466-23841488 TGGTGTGGGGCTATGGGGGAGGG + Intergenic
1171902685 20:30871988-30872010 TGGTGTGTGCTTATGATGCAGGG - Intergenic
1172314918 20:33946285-33946307 AGGGCTGTGCCTAAGGTGCATGG - Intergenic
1173596318 20:44260799-44260821 TGGTGTGTGTCTGGGGAGGAGGG + Intronic
1174412365 20:50344299-50344321 TGGTGGGTGCCCAAGCTGGGGGG + Intergenic
1176135975 20:63522172-63522194 TGGTGTGTGCCTGAGCTGTGTGG + Exonic
1176887685 21:14275432-14275454 TGGTGGGGGGCTGAGGTGGAAGG + Intergenic
1178344019 21:31809669-31809691 TAGTGGTTGCCTAAGGTTGAGGG + Intergenic
1179644030 21:42764619-42764641 TGGTGTGTCCCCACGGTGGATGG - Intronic
1179668287 21:42927516-42927538 GGGCGTGTGCCCAAGGTGGTCGG + Intergenic
1180336075 22:11577959-11577981 TGGTGTGTGCTTATGATGCAGGG - Intergenic
1182060259 22:27392360-27392382 TGGGGTGTGCCTGGCGTGGATGG - Intergenic
1182794183 22:32978338-32978360 AGGTTTCTGGCTAAGGTGGAAGG + Intronic
1183866723 22:40710195-40710217 CTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1184321211 22:43743541-43743563 TGGTGTGTGCTTAAGATGAAAGG + Intronic
1184406044 22:44301349-44301371 TGCTGTGTCGCTAAGGTGGAGGG + Intronic
1185030547 22:48440776-48440798 TGGTGTGTGCCTCAGGTGGATGG - Intergenic
1185312351 22:50163082-50163104 TGGCGTGTGCCCAGGGTGGCAGG + Intergenic
949869389 3:8574953-8574975 TGGTGTGTGCCTCAGTTGACAGG + Intergenic
950191079 3:10976564-10976586 TGGTGTGTGTATAGGTTGGATGG - Intergenic
950595544 3:13977658-13977680 TGGTGTCTGCCGGGGGTGGAAGG + Intronic
952193538 3:31048431-31048453 TGGTGTGTGCATGGAGTGGAAGG + Intergenic
954532451 3:51332847-51332869 CAGTGTATGCCTAAGGTGGCTGG + Intronic
958643674 3:96841038-96841060 TGATGTGTGCCCAAGGTGGTAGG + Intronic
959896540 3:111613045-111613067 TGTTGTGTGCCCCAGGTGGAAGG - Intronic
960416454 3:117390743-117390765 TGGTGTTTCCCTAAGGTAAATGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960708626 3:120505526-120505548 TGGTGTGTGTGTGTGGTGGAAGG - Intergenic
962117668 3:132529120-132529142 TGGTGGGTGCCAAAGGTTGGGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965708744 3:171535657-171535679 TGGTGTGTGCAGAAGATAGATGG - Intergenic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
968293708 3:197557220-197557242 TGACATGTGCCTAAGGTGGTTGG - Intronic
968975526 4:3820388-3820410 AGGAGTGTCCCTAAGGTTGATGG - Intergenic
973027715 4:45293438-45293460 TGGTGTGTGACTATGGGGGCAGG + Intergenic
975859544 4:78662005-78662027 TGGTGTTTGCCTAAGTAGGGAGG + Intergenic
980632782 4:135458177-135458199 AGATGTGTGCCTAAGGAGGAGGG + Intergenic
982951645 4:161704352-161704374 GGATGTGTGCCCAAGGTGGTCGG - Intronic
984186783 4:176554090-176554112 TGGTGTGTGCTAAGGGTTGAGGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
988773666 5:34456060-34456082 TGATATGTGCCCAAGGTGGTTGG + Intergenic
988921949 5:35951265-35951287 TGGTGTTTGAATAGGGTGGAAGG - Exonic
990695283 5:58409434-58409456 TGATTTGTGCCCAAGGTGGTCGG - Intergenic
990742656 5:58928070-58928092 GGGTGGGGGCCTAAGGAGGAAGG - Intergenic
991403964 5:66283792-66283814 TGGTGTGTGCCTGACATGGTGGG + Intergenic
995131027 5:108630670-108630692 GGGTGTGTGCGTAAGGTGGGTGG + Intergenic
997991808 5:138550741-138550763 TGGTGGGAGGCTGAGGTGGATGG + Intergenic
998232399 5:140369188-140369210 TGGTGTGTGCCTAAGGTGGAAGG + Intronic
999087263 5:148903926-148903948 TTTTGTGAGCCAAAGGTGGATGG - Intergenic
999089246 5:148921000-148921022 TGGAGGGTGCCAAAGGTGGCTGG - Intergenic
1003476577 6:6489153-6489175 GGGTGTGTCCCGCAGGTGGAGGG - Intergenic
1004382517 6:15144830-15144852 AGGTGTGAGCCTGAGGTGGGAGG - Intergenic
1005608035 6:27495374-27495396 TGATTTGTGTCTTAGGTGGAGGG - Intergenic
1006693021 6:35906630-35906652 TAGTGGCTGCCTAAGGTTGAAGG + Intronic
1006791313 6:36703133-36703155 TGGTGTCTTCCCATGGTGGAAGG + Intronic
1007366865 6:41400368-41400390 TTGTGTATGCCCTAGGTGGATGG - Intergenic
1011497544 6:87951400-87951422 TGGTGGGTGCTTGAGGTAGAAGG - Intergenic
1011706370 6:90005176-90005198 TGGGTTTGGCCTAAGGTGGATGG + Intronic
1012042298 6:94223684-94223706 TGGTTTTTGCCTATGGTGTAAGG + Intergenic
1012548906 6:100450062-100450084 TTGTTTGGGCCTAGGGTGGAAGG + Intronic
1013066542 6:106689450-106689472 TGGTGTGGGGCTGAGGTGGGAGG - Intergenic
1016048559 6:139505835-139505857 TGACATGTGCCTAAGGTGGTCGG + Intergenic
1016146956 6:140689580-140689602 TGGTGTCAGCTTAAGGGGGAGGG - Intergenic
1017793357 6:157821117-157821139 TGGTGGAGGGCTAAGGTGGAAGG - Intronic
1017800864 6:157894957-157894979 TGGTGTGTGCTGAAGATGAAGGG + Intronic
1018866515 6:167750824-167750846 TGACGTGTGCCCAAGGTGGTTGG - Intergenic
1019511944 7:1422070-1422092 AGGTGTGTGGCTCAGTTGGAGGG + Intergenic
1020207298 7:6129053-6129075 TTGTGTGAGCCTGAGGTGGGCGG - Intronic
1021391802 7:20102295-20102317 TGGTGAGTGCCCAAAGTGCATGG + Intergenic
1021645073 7:22781986-22782008 TGGTGAACGCCTAAGGAGGATGG - Intergenic
1024482040 7:49873570-49873592 TGGTGTGAGCATGAGTTGGAAGG + Intronic
1026213303 7:68325867-68325889 TGGTGTGTGCCTATGGTCCCAGG - Intergenic
1027340851 7:77206505-77206527 TGGTGTGTGCCTCAGCTACATGG + Intronic
1029345588 7:99976255-99976277 TTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1029346198 7:99980520-99980542 TTGTGTGTGCCTGGGGCGGAAGG - Intergenic
1029558979 7:101289995-101290017 TTGTGTGTGCCTGGGGCGGAAGG + Intergenic
1030782383 7:113617577-113617599 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1031424550 7:121589273-121589295 TGATCTGTGCCCAAGGTGGTTGG - Intergenic
1032700412 7:134373985-134374007 TGGTGTGTGCCTTAGGGAAAGGG - Intergenic
1033670283 7:143485933-143485955 TGCTGGGTGGCTATGGTGGATGG - Intergenic
1034511359 7:151537551-151537573 TGCTGTTTGCCTAATTTGGAGGG + Intergenic
1034860987 7:154594690-154594712 TGGTGTGTGCCAAGGGCGGAGGG - Intronic
1036750051 8:11438069-11438091 TGGGGTGAGGCCAAGGTGGATGG - Exonic
1036985452 8:13523876-13523898 TGGTATGTTCCCAAGGGGGAGGG + Intergenic
1040450809 8:47544522-47544544 AGGTGTGAGACTTAGGTGGAAGG + Intronic
1043852725 8:85233140-85233162 TGGTTTGTGCATCTGGTGGATGG + Intronic
1047125171 8:121951878-121951900 TGGCATGTGCCCAAGGTGGTCGG - Intergenic
1047219361 8:122907218-122907240 TGACATGTGCCTAAGGTGGTTGG + Intronic
1047739952 8:127798378-127798400 CTGTTTGTGCCTAAGGTGCACGG - Intergenic
1048199982 8:132364502-132364524 TGGTGAGAGCCTAGGCTGGAGGG + Intronic
1048520124 8:135146117-135146139 TGACATGTGCCTAAGGTGGTTGG + Intergenic
1048751755 8:137684911-137684933 TGATGTGTGCCCATGGTAGAGGG - Intergenic
1049096593 8:140551828-140551850 TGATGGGTGCATAAGGTGAATGG + Intronic
1052951676 9:34218580-34218602 TGGTATGTGCCTACGTGGGAAGG + Intronic
1054714171 9:68540815-68540837 TGCTGGGTTCCTAAGGTGCAAGG - Exonic
1054911541 9:70459696-70459718 TGACATGTGCCCAAGGTGGATGG - Intergenic
1057496840 9:95568008-95568030 TGGTGTGTGTTTAATGTGTATGG + Intergenic
1058245252 9:102615281-102615303 TGATATGTGCCCAAGGTGGTTGG - Intergenic
1061264836 9:129498962-129498984 TGGGTTGTGCCTCAAGTGGAGGG - Intergenic
1062058517 9:134482040-134482062 TGGAGTGTGGTAAAGGTGGAAGG - Intergenic
1185890289 X:3816275-3816297 TGGTGTGTGCTAGTGGTGGAGGG + Intergenic
1186844433 X:13516761-13516783 AGGTGGGGGCCTGAGGTGGACGG + Intergenic
1186873346 X:13793396-13793418 TAACATGTGCCTAAGGTGGACGG - Intronic
1188864962 X:35303562-35303584 TGGTGTGTGGCTATTGTGAATGG - Intergenic
1189862090 X:45283203-45283225 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1190361482 X:49653582-49653604 TGGTGGGAGGCTAAGGTGAAAGG - Intergenic
1190819686 X:53961704-53961726 TGGTGTTTGCTTGAGGTCGAGGG - Intronic
1191717405 X:64203265-64203287 TTGAGTGTGCCTAATGAGGATGG - Intronic
1194483260 X:94454043-94454065 TGAAATGTGCCCAAGGTGGATGG + Intergenic
1194906218 X:99578623-99578645 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1195688205 X:107603855-107603877 GAGTGTGAGCCCAAGGTGGATGG - Exonic
1199150551 X:144480228-144480250 TGGGGTGTACTTTAGGTGGAGGG - Intergenic
1199843513 X:151674243-151674265 GGGTGTGTGCCTTATGTGGAAGG - Intronic
1201409699 Y:13687027-13687049 TGATATGTGCCCAAGGTGGTTGG + Intergenic