ID: 998233108

View in Genome Browser
Species Human (GRCh38)
Location 5:140374235-140374257
Sequence TTGGAGAAGCATGAAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998233108_998233111 -1 Left 998233108 5:140374235-140374257 CCCTCATCTTCATGCTTCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 411
Right 998233111 5:140374257-140374279 AGCTCAAGAGCCTAAGAGCCAGG 0: 1
1: 0
2: 2
3: 18
4: 201
998233108_998233115 12 Left 998233108 5:140374235-140374257 CCCTCATCTTCATGCTTCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 411
Right 998233115 5:140374270-140374292 AAGAGCCAGGCCAGGCACGGTGG 0: 2
1: 16
2: 212
3: 1490
4: 7702
998233108_998233112 4 Left 998233108 5:140374235-140374257 CCCTCATCTTCATGCTTCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 411
Right 998233112 5:140374262-140374284 AAGAGCCTAAGAGCCAGGCCAGG No data
998233108_998233114 9 Left 998233108 5:140374235-140374257 CCCTCATCTTCATGCTTCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 411
Right 998233114 5:140374267-140374289 CCTAAGAGCCAGGCCAGGCACGG 0: 1
1: 0
2: 8
3: 65
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998233108 Original CRISPR TTGGAGAAGCATGAAGATGA GGG (reversed) Intronic
900004499 1:35930-35952 TTGGAGGAGAATGGAGCTGAAGG + Intergenic
900024221 1:206446-206468 TTGGAGGAGAATGGAGCTGAAGG + Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900906015 1:5558207-5558229 GTGGAGAGTCATGAAGAGGAGGG + Intergenic
901218627 1:7569511-7569533 TTGGAGAATGATGAAGGTAATGG - Intronic
901455169 1:9358997-9359019 TTGGAAAATCCTGAAGATGTTGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
906108098 1:43306654-43306676 CTGGTGGAGCATGAAGAAGAGGG + Intronic
906261747 1:44397073-44397095 CTGGAGAAGGATGTGGATGAAGG + Intergenic
906315347 1:44783482-44783504 ATGCAGTAGGATGAAGATGAAGG - Intergenic
906874144 1:49517498-49517520 TCAGAGAAGCATGAAGACAAAGG + Intronic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
908460628 1:64345455-64345477 TGGGAAATGCATGAAGATGAGGG + Intergenic
908620963 1:65979022-65979044 TTGAAGAAAGATGAAGATGATGG - Intronic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
910749202 1:90609943-90609965 TTAGAAAAGGATGAAGATGCTGG + Intergenic
910950763 1:92645724-92645746 TTGGACAAGGATGAATATGGGGG - Intronic
911125255 1:94335386-94335408 GTGGAGAAGAATGAGGCTGAGGG - Intergenic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
912499602 1:110113259-110113281 TAGGGGAAGCATGGTGATGAGGG - Exonic
913073191 1:115319244-115319266 ATGGAGAATCTTGAAGAAGAAGG - Intronic
915463413 1:156082482-156082504 ATGGAGCAGCATGAAACTGACGG + Intergenic
915464267 1:156087141-156087163 TGAGAGAAGTATGAAGATGGGGG - Intronic
915857506 1:159405389-159405411 TTGGAGAAGTAAGCACATGAAGG + Intergenic
916235352 1:162582311-162582333 TTGAAAAAGGATGAAGATAAGGG + Intronic
919230682 1:194769380-194769402 TTTGGTAAGCATGAAGATCAGGG - Intergenic
919275857 1:195415929-195415951 TAGGAGGAGGAGGAAGATGAGGG + Intergenic
920739606 1:208568031-208568053 TGGGATAAGCATGAAGGTGGGGG + Intergenic
920848933 1:209615555-209615577 CTGGAGAGGCATGAAGCTGGAGG - Intronic
923487123 1:234444019-234444041 TTGGAGATGGATGATGGTGATGG + Intronic
924830516 1:247589129-247589151 CTGCAGATACATGAAGATGATGG - Exonic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063343127 10:5286990-5287012 GAGGAGAAGGAGGAAGATGAAGG - Intergenic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1068623813 10:59216758-59216780 TTGGAGAAGCTTGGTTATGAAGG + Intronic
1068965908 10:62911912-62911934 TTGGGGAATGATGAAGATCAGGG + Intronic
1069359177 10:67622434-67622456 TTGGAGAACCCTGAAAAAGAGGG + Intronic
1070607497 10:77909228-77909250 CATGAGAAGCCTGAAGATGAGGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071430833 10:85605405-85605427 TTGGAGAAGCCTGAACAAGCTGG + Intronic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1072070364 10:91909300-91909322 TTGGAGAAGGGAGAAAATGAAGG - Intronic
1072227978 10:93387672-93387694 TTGTAGAAACATCCAGATGAGGG + Intronic
1072433363 10:95393466-95393488 GTAGAGAAGCATCAAGATGGTGG + Intronic
1073638465 10:105223482-105223504 TTAGAGAAGCAAGAACATGCAGG - Intronic
1073696969 10:105880412-105880434 TTGGAGAAGCACGAAAAAGGGGG - Intergenic
1074202008 10:111245770-111245792 TTGGAGAGGCAGGAAGATTTTGG + Intergenic
1074884088 10:117681234-117681256 TTTGCCAAGCATGAGGATGAAGG - Intergenic
1075186475 10:120263538-120263560 ATGTGGAAACATGAAGATGAAGG + Intergenic
1075445214 10:122508300-122508322 TGGGAGAAGCAGGAAGGTGTGGG + Intronic
1077425237 11:2472988-2473010 TGGGAGAAGCCTGCATATGAAGG + Intronic
1078044088 11:7897360-7897382 TTCCAGAAACATGAAGATAATGG + Intergenic
1079214029 11:18490258-18490280 TCGGAAAACCAGGAAGATGAAGG - Intronic
1080793544 11:35542203-35542225 TGGGAGAAGAATGAAGACAAGGG - Intergenic
1080798410 11:35587294-35587316 TTGGAGAAGCACCAAGATCAGGG - Intergenic
1080890633 11:36406073-36406095 TGGGAGAAGGATTAAGTTGATGG + Intronic
1082889016 11:58118662-58118684 TTGCAGATACATGAAGATAAGGG + Exonic
1083012510 11:59416754-59416776 TGGGAGAATCATCAAGATGTGGG - Intergenic
1084114975 11:67037401-67037423 TTGGGGAACCATGAAAATTATGG + Intronic
1084201393 11:67560875-67560897 TTCCAGGAGCATGAAGATAATGG - Intergenic
1084235398 11:67785037-67785059 TTGGGGAAGCCTGGAGAGGAGGG + Intergenic
1088042628 11:105406244-105406266 TTGGAGAAAAATTAAGATGAAGG + Intergenic
1088156700 11:106814041-106814063 CTGTAGAAGCCTGAAGGTGAAGG + Intronic
1088800957 11:113306736-113306758 TTAGAGAAGGAGGAAGCTGAAGG - Intergenic
1089598491 11:119598115-119598137 TGGGAGAAGGATGGAGATGTGGG + Intergenic
1090132543 11:124159792-124159814 TTGTAGATGCATAAAAATGAGGG - Intergenic
1090451848 11:126813213-126813235 CTTGGGAGGCATGAAGATGAAGG + Intronic
1090775888 11:129965489-129965511 TAGGAGACGCAAGAAGATGAGGG - Intronic
1090853348 11:130589736-130589758 TTGGAGGAGGAGGAAGCTGAAGG - Intergenic
1091093910 11:132799438-132799460 ATGGAGAAGGAAGGAGATGAGGG + Intronic
1091116010 11:133014175-133014197 TTAGAGAAGCAACAAGATAATGG - Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091358005 11:134953048-134953070 TAGGAGAAACAGGGAGATGATGG + Intergenic
1091377918 12:37982-38004 TTGGAGGAGAATGGAGCTGAAGG + Intergenic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1092641207 12:10512587-10512609 GAGGACAAGCAAGAAGATGAGGG - Intronic
1093197743 12:16148714-16148736 TTGGAGAAGTTTAAAGATAAAGG + Intergenic
1093637413 12:21488026-21488048 TTGGAAAAGAATGACTATGAAGG - Intronic
1093808323 12:23463859-23463881 TTGGAGATGAATGGTGATGATGG + Intergenic
1094467619 12:30770364-30770386 TTTGTGGAGCATGAAGTTGAGGG - Intergenic
1094787665 12:33869011-33869033 TTGGAGTAGGATGATGATGTTGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1096084676 12:48857643-48857665 TGGAAGAGGCATGAAGCTGAAGG + Exonic
1097091930 12:56512809-56512831 TTGGAGAAAAATGAAGAAAAAGG + Intergenic
1097455187 12:59791718-59791740 TTGAAGAAGAATAAAGTTGAAGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098915700 12:76254817-76254839 TTAGAGAAGGATTCAGATGAAGG - Intergenic
1100376579 12:94021696-94021718 CTGGAGATGGATGATGATGATGG + Intergenic
1100747119 12:97658456-97658478 TTTTAGAAGGATGAAGATGGAGG - Intergenic
1101321925 12:103680193-103680215 TTGGAGAAGGATGGTAATGATGG + Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101824413 12:108209559-108209581 GTGTAGAAGGGTGAAGATGAAGG + Intronic
1101858956 12:108467168-108467190 ATGGAAAAGCATGAAACTGAGGG + Intergenic
1102077113 12:110068400-110068422 TTGGACATGGATGAAGATAAGGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1103875844 12:124126487-124126509 TAGGAGAAGAAGGAAGATGTGGG + Intronic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1105943706 13:25172042-25172064 TGGGAAAGGCATGAAGATGCAGG - Exonic
1106318790 13:28619079-28619101 TGGGACAAGCATGAAATTGAAGG + Intergenic
1107255646 13:38423054-38423076 TTAGAGATTCATGAAAATGATGG - Intergenic
1108910764 13:55548847-55548869 ATTCAGAAGCATGAAGATAATGG + Intergenic
1110792902 13:79604988-79605010 TTGGAGAAGAACGTAGATTATGG + Intergenic
1111147384 13:84201784-84201806 GAGGAGAAGCATGAACATAAAGG - Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1111280740 13:86020478-86020500 TTGAAGAAACATGAAGTTCAGGG + Intergenic
1111855726 13:93634671-93634693 TTCTAGAAGCATGAAGGAGAGGG + Intronic
1112252859 13:97799657-97799679 TTGGAGAACCATCCAGATAATGG + Intergenic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112517838 13:100070830-100070852 TGGGAGAAGGAGGAAAATGAGGG + Intergenic
1113664582 13:112132309-112132331 TTGTGGAAGCATGAAGTGGAGGG + Intergenic
1114405760 14:22454532-22454554 TTGGAGAATCACTAACATGAAGG - Intergenic
1114972058 14:28043728-28043750 TTGGAGATGGATGATGGTGATGG + Intergenic
1115050766 14:29059935-29059957 ATGGAGAAGCTTGAAGAAGGAGG + Intergenic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117557955 14:56906074-56906096 TTTGAGAAGCTTGATTATGAAGG + Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1120299411 14:82687311-82687333 AAGGTGAAACATGAAGATGATGG + Intergenic
1120724613 14:87923810-87923832 TTGGAGAAGGAAGGAGATGGAGG + Intronic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1122464931 14:101925569-101925591 TTGGGAGAACATGAAGATGAAGG - Exonic
1122653684 14:103242321-103242343 TTTCAGAAACATGAAGATAATGG + Intergenic
1122655162 14:103253860-103253882 TTCCAGGAGCATGAAGATAATGG + Intergenic
1125190129 15:36982044-36982066 TTGGAGAAACAGGAAAGTGATGG - Intronic
1125235941 15:37513535-37513557 CTAGAGAAACAAGAAGATGATGG - Intergenic
1125762426 15:42105766-42105788 TTAAAGAAGTATAAAGATGAAGG - Intergenic
1125865373 15:43042619-43042641 TTGGAGAAGGATGGTGGTGATGG + Intronic
1126161633 15:45619433-45619455 TTGGAGGAGCAAGAGGCTGAGGG + Intronic
1126913601 15:53441021-53441043 ATGGAGAAAGCTGAAGATGATGG + Intergenic
1127144011 15:56006596-56006618 TTGAAGGAGCGTGAATATGATGG - Intergenic
1128118111 15:65125158-65125180 TTACACAAGCATGAAAATGAAGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128829254 15:70751711-70751733 CTGGAGCAGCATGAAGGTGCAGG - Intronic
1130775931 15:86982894-86982916 CTTGAACAGCATGAAGATGAGGG - Intronic
1132315828 15:100889694-100889716 ATGGGGCAGCCTGAAGATGAAGG - Intronic
1132418151 15:101639422-101639444 TTGAAAAAGCCTGAAAATGAAGG - Intronic
1132449009 15:101955014-101955036 TTGGAGGAGAATGGAGCTGAAGG - Intergenic
1132628884 16:906744-906766 TTGAAGAAGAATAAAGATGCAGG - Intronic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133535064 16:6693802-6693824 GTGGAGAATGATGATGATGATGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133720583 16:8490782-8490804 ATGGAGAACGATGGAGATGAAGG + Intergenic
1135646738 16:24169481-24169503 TTGGAGAAGAAAGAAGAAGGGGG - Intronic
1136106261 16:28032165-28032187 CTGGAGATGCACGAACATGATGG + Intronic
1136558050 16:31020289-31020311 GTGGAGGATCATGAGGATGATGG + Intergenic
1137334060 16:47531000-47531022 TTGGAGAAGGAAAAATATGAAGG + Intronic
1138062500 16:53906723-53906745 TGGTAGAAGCAGGAAGATGCAGG + Intronic
1139064193 16:63291937-63291959 TGGGAGAAGCCAGAAGAAGATGG - Intergenic
1139922417 16:70468575-70468597 TTGGAGAGGCATGGAGATCTGGG + Intronic
1139988532 16:70920471-70920493 TTAGAGATGCATGCAGTTGAGGG + Intronic
1140025134 16:71281837-71281859 TTTGATAAGAATGAAGTTGAAGG - Exonic
1140441083 16:74988352-74988374 TTCGAGAAACATGAAGATAATGG - Intronic
1141003962 16:80334982-80335004 TAGGAGCAGGATGAAGATGGAGG - Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141299925 16:82805026-82805048 AAGGAAAAGCATGAAGATAAGGG + Intronic
1142343465 16:89538733-89538755 TTGGAGACGCATGTGGAAGACGG - Intronic
1144188521 17:12820995-12821017 TTGGAAAAGCATAAAGATTAGGG - Intronic
1144368512 17:14568356-14568378 TCAGAGAAGCATGAACATCAAGG + Intergenic
1144955047 17:19014936-19014958 TTGGAGGAGCATGCAAATGGCGG + Intronic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1146636083 17:34506194-34506216 TGGGAGATGAAAGAAGATGAAGG - Intergenic
1146930931 17:36777288-36777310 TTGGGGAAACAAGAAGGTGAGGG + Intergenic
1147282794 17:39376556-39376578 TTGCAGAAGTAGGAAGTTGAAGG + Intronic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149383926 17:56123366-56123388 ATGGATAGGCTTGAAGATGATGG + Intronic
1149428943 17:56581536-56581558 TCGGGGCAGCATGAAGATGCAGG - Intergenic
1150302589 17:64058851-64058873 TGGGAGAGGCATGAATAAGAGGG - Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152084064 17:78206659-78206681 GAGGAGAAGAAAGAAGATGAAGG - Intronic
1152908167 17:82981513-82981535 TTCCAGGAGCATGAAGATAATGG - Intronic
1153090146 18:1333679-1333701 TTGGAGTATCAAGAAGGTGAGGG + Intergenic
1153419603 18:4890230-4890252 TTTGAGAAGCTAGAAGATAAGGG + Intergenic
1153772333 18:8425992-8426014 CTGGAGAAGGATGGAGATGCAGG + Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157902687 18:51535199-51535221 TTGAAGAAAAATGAAGCTGAAGG - Intergenic
1158623676 18:59053386-59053408 TTGGAAAAGAATGCAGAAGAAGG - Intergenic
1158753734 18:60297841-60297863 TTGGATGAGCATGGAGATAATGG + Intergenic
1158985126 18:62807423-62807445 GGGGAGAAGCATAAAGAAGAAGG + Intronic
1159311278 18:66713887-66713909 TTGGATAAAAATGTAGATGAAGG + Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160636251 19:77539-77561 TTGGAGGAGAATGGAGCTGAAGG + Intergenic
1163124154 19:15235458-15235480 TGGGAGAAGCGGGGAGATGAGGG - Intergenic
1163207782 19:15816007-15816029 TTGGAGAAGAATGAAGGTGACGG - Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1165291427 19:34889227-34889249 TTGGAGAACCCTGAACACGAAGG + Intergenic
1166018088 19:39998489-39998511 TTGGAGAAGATTGGAGAAGATGG - Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
925112485 2:1347860-1347882 TTCCAGGAACATGAAGATGATGG - Intronic
925332446 2:3069231-3069253 CTGGAGATGGATGATGATGATGG + Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925639115 2:5970619-5970641 TTGGAGAGGCAGGAAGAATATGG - Intergenic
925811699 2:7707747-7707769 TTAGAAAAGCATTATGATGAAGG - Intergenic
925919827 2:8631169-8631191 TTGGAGAAGCTTTAAGGTGGTGG - Intergenic
926058189 2:9788859-9788881 CTGAAGAAGAGTGAAGATGAAGG + Intergenic
926116879 2:10218939-10218961 TTGTAGCAGTATGAAGATGTGGG + Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
929938085 2:46309565-46309587 TTGGAGGAGCATGAAGACCTAGG + Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930344682 2:50165162-50165184 GTGGAGAAGTATGAAGTAGAAGG + Intronic
930572429 2:53103972-53103994 TTTGAGAAGCATGGAGTTCAGGG - Intergenic
933407399 2:81878509-81878531 ATGGAGAAGCAAGAATATTAAGG + Intergenic
933884271 2:86703320-86703342 TTGGAAAATCATGGAGAGGAGGG + Intronic
935634493 2:105239526-105239548 ATGGAGAGGAATGCAGATGAAGG + Intergenic
935684956 2:105674994-105675016 TTGGACAATCAAGAACATGAAGG - Intergenic
936375467 2:111937507-111937529 ATGGAGATGCATGGAGATGGGGG - Intronic
936565231 2:113577511-113577533 TTGGAGGAGAATGGAGCTGAAGG - Intergenic
939222444 2:139319605-139319627 TGGGAGAAGAATGAAGATCTGGG + Intergenic
940577978 2:155538370-155538392 TTGAAAAAGGATAAAGATGAAGG - Intergenic
941350777 2:164432017-164432039 TTGGTGCTGCATGAATATGAAGG + Intergenic
942689038 2:178565709-178565731 TGGGAGAAACCTGAACATGATGG - Exonic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944271501 2:197788719-197788741 TTGGACAAGCTTGAAGAACAAGG + Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945302344 2:208226231-208226253 TAGAAGAAGGCTGAAGATGAAGG - Intergenic
945873150 2:215249130-215249152 TTGGAGAAGGAGGAAGATAGAGG - Intergenic
946811683 2:223531937-223531959 TTACAGAAGCGTGAAGAAGAGGG - Intergenic
946963538 2:225010893-225010915 ATTTAGAACCATGAAGATGATGG - Intronic
947309713 2:228787936-228787958 TGAGAGAAGCATGGAGAAGAGGG + Intergenic
947968242 2:234300378-234300400 TTTTAGAAACATGAAGGTGAGGG + Intergenic
1169934912 20:10873037-10873059 TGACTGAAGCATGAAGATGAAGG - Intergenic
1170838400 20:19904427-19904449 TTGGAGAAACTTGAACTTGAAGG + Intronic
1170838492 20:19904994-19905016 CTGGAGAAGCTTGAACTTGAAGG - Intronic
1171078497 20:22153573-22153595 TTTGAGAACCTTTAAGATGATGG + Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1172265967 20:33614491-33614513 TTGGAGATGGATGGTGATGATGG - Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1172787129 20:37475759-37475781 TTGGAGAAGCAAGTGGATTAGGG - Intergenic
1173432713 20:43005074-43005096 TAGGAGGAACATGATGATGAAGG - Intronic
1173620075 20:44429930-44429952 TTGGACATGGATGAAGGTGAAGG - Exonic
1174768337 20:53274293-53274315 CTGGAGAAGCATGAAAATAGTGG - Intronic
1175589762 20:60179770-60179792 TTGGAGATATATGAAGGTGAGGG - Intergenic
1176982830 21:15403046-15403068 CTTGAGTAGCAGGAAGATGAAGG + Intergenic
1177891724 21:26812653-26812675 TTGGAGATGAATGATGGTGATGG - Intergenic
1181283771 22:21737575-21737597 CTGGAGAGGGATGATGATGATGG - Intergenic
1181426916 22:22849709-22849731 TTGGAGGAGGAGGAAGATGATGG + Intronic
1181563281 22:23717806-23717828 TTGAAGACACATGAAGATGCAGG + Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1183602763 22:38849707-38849729 TTGGGGAATCATTCAGATGAAGG + Intergenic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184087508 22:42274052-42274074 TTGGTGAAGGATAAAGGTGAGGG - Intronic
1184354192 22:43967617-43967639 TGGGAGAAGCCTGCAGGTGAAGG - Intronic
1184526074 22:45023722-45023744 TTTGTGAAGGATTAAGATGAGGG - Intergenic
949218942 3:1606460-1606482 TGGGAGTGGCATGAACATGAGGG + Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949676397 3:6459141-6459163 TTTGAGATGAATGAAAATGATGG - Intergenic
949912954 3:8929279-8929301 TTTGAGAAAAATGAAGCTGAAGG + Intronic
951047974 3:18062603-18062625 TGGGAGAAGGATGTAGAAGATGG - Intronic
951113317 3:18831701-18831723 TAGGAGAAGCATGGAGTTGAGGG + Intergenic
952043725 3:29291905-29291927 TGGGATAAGAATGAAAATGAAGG - Intronic
952109219 3:30103606-30103628 TTGTTGAAGGATGAAGATGAAGG + Intergenic
953154477 3:40356679-40356701 CTGGAGAAGGGTGAAGATGCTGG + Intergenic
953282819 3:41575283-41575305 TTGGAGTAGGATGAAGGTGCTGG + Intronic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954261712 3:49443840-49443862 TTCCAGGAGCATGAAGATAATGG + Intergenic
954449238 3:50562825-50562847 TTGTACAACCTTGAAGATGAGGG + Intronic
954684681 3:52364044-52364066 TTGGAGCTGCATGAAGAGGCTGG - Intronic
956000367 3:64723584-64723606 CTGGAGAAGGATGATGCTGATGG + Intergenic
956064284 3:65380433-65380455 CTGGAGATGGATGATGATGATGG - Intronic
956283640 3:67585616-67585638 TGGGAGAAGCATCAGCATGATGG - Intronic
956291116 3:67661346-67661368 TTGGAGCTGGATGAAGAAGATGG + Intergenic
957167359 3:76692071-76692093 TGGGAGAAGAATGGAGATGTAGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
958932948 3:100226988-100227010 TTGCAGAGGCATTAAGAAGAAGG + Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959743417 3:109747898-109747920 TCAGACAAGCATGAAGGTGAAGG + Intergenic
959787731 3:110320788-110320810 TTAGACAAGCATAAAAATGAAGG + Intergenic
960351299 3:116596601-116596623 TGGGAGAAGAAAGAAAATGAGGG - Intronic
963877171 3:150489364-150489386 TTCCAGGAACATGAAGATGACGG - Intergenic
964660007 3:159110051-159110073 TTGCTAAAGCATGAAGTTGAAGG - Intronic
964769140 3:160206055-160206077 TGGGAGAAGCATGAACAAAAGGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
966040815 3:175485669-175485691 TAGAAAAAGCAGGAAGATGAAGG - Intronic
966654702 3:182342603-182342625 TTTGAGAAGAATGAAGATTTGGG - Intergenic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
968309697 3:197673315-197673337 TGGGAGAGGCATTAAGGTGATGG - Intronic
968437418 4:601137-601159 TTGGAATAGACTGAAGATGAGGG - Intergenic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971419783 4:26464859-26464881 TTGGAGAAGAAGGGAGGTGACGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971832173 4:31708995-31709017 ATGGAGTAGGATGAAGTTGAAGG - Intergenic
972592506 4:40501248-40501270 ATGGAGAAACATGAAGACAAAGG + Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973829371 4:54742906-54742928 TTGGGGAAGGGTGAAGAGGAAGG + Intergenic
973882820 4:55291002-55291024 TTGGGGAAGCATCACTATGAAGG - Intergenic
974456851 4:62139346-62139368 TTGTAGAATCATGAAGAAAATGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976306155 4:83561444-83561466 TTGCAGAGGCAAGAAGAAGAAGG - Intronic
978635640 4:110802445-110802467 CTGGAGAAACATGAAGAAGGTGG + Intergenic
978648617 4:110972663-110972685 TTAGAAAAGCATGAGGATCAAGG - Intergenic
979325224 4:119371367-119371389 TTGGAGAAACATGAAGTAGAAGG - Intergenic
979817102 4:125122641-125122663 TTGGGGATGCAGGAAGATGAAGG + Intergenic
980350952 4:131682839-131682861 TTGGAGAAGAATTTAGCTGAAGG - Intergenic
981202754 4:142000709-142000731 TTGGAGAAGGATGGTGCTGATGG + Intergenic
981478918 4:145216080-145216102 CTGGAGATGCATGGTGATGATGG - Intergenic
983243127 4:165256385-165256407 TTGGAGAAACATGAAGTAGAAGG - Intronic
983498481 4:168472326-168472348 TTGGAGCAGCTTGGAGATGATGG - Intronic
984213632 4:176880689-176880711 TTGGGAAAGCAAGAAGATGTGGG + Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
989119820 5:37993233-37993255 TTTGATAAGCATGAAGATGGAGG - Intergenic
989194044 5:38698790-38698812 TTGGAGAACCATGTAGATGCTGG - Intergenic
989560866 5:42849330-42849352 ATGGAGATGGATGGAGATGATGG + Intronic
990558089 5:56955108-56955130 TTGGAGAAGCATACAAATGTAGG + Intronic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
994338208 5:98594563-98594585 TTGAGGAAGAATGAAGTTGAGGG - Intergenic
994541061 5:101098008-101098030 TTGAAGAAGAATAAAGTTGATGG - Intergenic
995478886 5:112575847-112575869 GTGGAGAAGTAAGAAGATGCAGG + Intergenic
995677407 5:114677957-114677979 CTGGAGGAGGATGAAGATCAGGG + Intergenic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
997154148 5:131533950-131533972 TAGCAGAAGCATGAAGAACAAGG - Intronic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997588346 5:135057773-135057795 GTGGAGATGCCTTAAGATGAAGG + Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998501302 5:142635333-142635355 TTTGAGCAAGATGAAGATGACGG - Intronic
998623641 5:143821785-143821807 CTGGAGATGGATGAAGGTGATGG + Intergenic
999140629 5:149358956-149358978 TTGGAGATGCATCAAAATGTAGG - Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
999928116 5:156401859-156401881 TTGGAGATGGATGATGATGATGG - Intronic
1000684575 5:164231840-164231862 TTCGAGAAACAAGAACATGAAGG - Intergenic
1001132793 5:169078617-169078639 TCTTAGAAGGATGAAGATGAAGG - Intronic
1001712759 5:173791301-173791323 TTGGAGATGCAAGAATATTAGGG + Intergenic
1002588681 5:180271501-180271523 TTGAAGAAGCGTGAAGATTAGGG - Intronic
1002995369 6:2278118-2278140 TTGGAGAAACATGAAGACGTTGG - Intergenic
1003302391 6:4895994-4896016 TTGGAGAAAAATGATGGTGAGGG - Intronic
1003766522 6:9243212-9243234 TGGGGGAAGAATGAAGATGATGG + Intergenic
1004099716 6:12596619-12596641 TTGAACAAGCATGTATATGAGGG - Intergenic
1004272611 6:14209417-14209439 TTGGAGAAGCATAACCATTAAGG + Intergenic
1004525056 6:16399779-16399801 TTGGGGAAGCAGGGAGATGGAGG - Intronic
1004684343 6:17928226-17928248 ATAGAGAAGCATGCACATGAGGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1007536052 6:42590210-42590232 TTGTAAAAGCTTGGAGATGATGG + Intronic
1008368254 6:50707048-50707070 TTGGAGAGGGATGGAGATGGTGG + Intergenic
1010984949 6:82413097-82413119 TGGGAGAAACTTGAAAATGAAGG + Intergenic
1014301754 6:119690376-119690398 TTGGAGAAAAATCAAGATTAAGG - Intergenic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018634638 6:165849985-165850007 TTGGGGAAGCGGGAAAATGATGG - Intronic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019169064 6:170118984-170119006 TTGGAAAAGAATAAAGTTGAAGG - Intergenic
1020275826 7:6623854-6623876 TCTGAGAAGCATGAAGCTGGTGG - Exonic
1020489318 7:8759626-8759648 TTACAGAAGCATGAAGGAGATGG + Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1020943341 7:14568312-14568334 TTGGAAAAGCATTAAAAAGAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023573523 7:41598823-41598845 TTAGAGATGAATGAAAATGAAGG + Intergenic
1024180366 7:46886935-46886957 TTGGAGCAGTATGATCATGATGG - Intergenic
1024375587 7:48634827-48634849 TTTGAGATGAATGAAAATGAAGG - Intronic
1024836588 7:53526680-53526702 CTGGAGATGCATGGAGGTGATGG + Intergenic
1026103147 7:67399163-67399185 TTGGAGAGCCATGGAGCTGATGG + Intergenic
1026324407 7:69296318-69296340 TTGGCCAAGCATCAAGAAGAAGG + Intergenic
1027446428 7:78278987-78279009 TTGAAGAAAAATGAAGATGATGG + Intronic
1027614452 7:80404032-80404054 TTCCAGGAGCATGAAGATAATGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1029521664 7:101066661-101066683 CTGGGGATGCATGGAGATGAGGG + Intergenic
1031806550 7:126314891-126314913 TTGGAGAAGCATGAATAGATTGG + Intergenic
1031813460 7:126401992-126402014 CTAGAGAAGGATGAAGAAGAGGG - Intergenic
1032293710 7:130615090-130615112 TTGGTGTAGCATGAAGGTCATGG + Intronic
1032700499 7:134374603-134374625 GTGGAGAAGCATGAATGGGAGGG - Intergenic
1032799530 7:135307171-135307193 TTGCAGGAGCATGCAGATGCTGG + Intergenic
1034050796 7:147982586-147982608 ATGGAGATTCATCAAGATGATGG + Intronic
1035086938 7:156268221-156268243 ATTGAAAAACATGAAGATGATGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035811240 8:2493049-2493071 GTGGAGAAGAAGGGAGATGAAGG + Intergenic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039299077 8:36189995-36190017 GTGGAAAAGAATGGAGATGATGG - Intergenic
1039769509 8:40669514-40669536 GTGGAGTAGGATGAAGAGGAGGG - Intronic
1039836259 8:41258673-41258695 CTGCAGATGCATGAAGATGCAGG + Intergenic
1040483793 8:47851644-47851666 CTGGAGAATCATGAACATAAAGG + Intronic
1040671216 8:49692685-49692707 TTGAAGAAATATTAAGATGATGG - Intergenic
1041141200 8:54820948-54820970 TAGGCGAAGCAGCAAGATGAGGG + Intergenic
1041438234 8:57865025-57865047 CTGGAGAAGGATGATGGTGATGG - Intergenic
1041533730 8:58902346-58902368 TTGGATCACCATGCAGATGATGG - Intronic
1041687347 8:60656671-60656693 ATGGAGGAGCATGAGGGTGATGG - Intergenic
1042235419 8:66607504-66607526 TTGGTGAAGCTGGAAGATTAGGG - Intronic
1042911760 8:73835089-73835111 TAGGAGAAGCAAGAATATAAAGG + Intronic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043133127 8:76487282-76487304 TAGGAGTAGGATTAAGATGATGG - Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1045769790 8:105722703-105722725 GAGGAGAAGGAGGAAGATGAGGG + Intronic
1046669053 8:117037430-117037452 TTGGAGGAGAATGGAGAGGAAGG + Intronic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1048237164 8:132701949-132701971 TTGGATAAACATCAAGATGTTGG + Intronic
1048249108 8:132844147-132844169 TTGGAGAAGAATCCAGCTGAAGG + Exonic
1048414065 8:134206914-134206936 TTGGGGGAGGATGATGATGATGG + Intergenic
1048820565 8:138376562-138376584 CTGGAGAAGTAAGAAGTTGATGG - Intronic
1049287536 8:141783947-141783969 TTGGGGAGGCAGGAACATGAGGG - Intergenic
1049698719 8:143996776-143996798 TTGGGGAAGCAGGTAGAAGAAGG + Intronic
1049736442 8:144209240-144209262 TTGAAGAAGAATAAAGTTGAAGG - Intronic
1049887194 9:35713-35735 TTGGAGGAGAATGGAGCTGAAGG + Intergenic
1050283287 9:4074894-4074916 TTGGAGAAGAAAGAAGATCATGG - Intronic
1050471443 9:5995299-5995321 TTTGAGAAGCAGGAAGTTAATGG - Intronic
1051997911 9:23241349-23241371 TTGCAAAAAAATGAAGATGAGGG + Intergenic
1052181002 9:25527675-25527697 TTTGAGTAGCTTGAGGATGAAGG - Intergenic
1052510570 9:29413916-29413938 CAGGAGTAGCATGAATATGAAGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1053217075 9:36280554-36280576 TAGGAGAAGCATGAAGGAGGAGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055851528 9:80636579-80636601 TTGGAATAGCATGAGAATGAGGG - Intergenic
1056515532 9:87345765-87345787 TTGGAGAACCTTCAAGATGGCGG - Intergenic
1056725376 9:89109716-89109738 CTGGAGATGCCTGAAGATGTTGG - Intronic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057825172 9:98367536-98367558 TTGGAGATGGATGGTGATGATGG + Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1058935301 9:109764314-109764336 TTGGAGAAGGATGTACAAGATGG - Intronic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1061418881 9:130462613-130462635 TTGGGGAAACATGAAGCTGTGGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186086251 X:5993682-5993704 GTGGTGAAGGATGAAGATGCCGG + Intronic
1186268008 X:7852456-7852478 CTGGAGGAGGAAGAAGATGAAGG + Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188656496 X:32703802-32703824 TTTGAGGAGTATGAAAATGATGG + Intronic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1190042117 X:47079858-47079880 TGGGAGAAGGATGAAGATGCAGG + Intronic
1190556637 X:51642231-51642253 TAGGAAAAGCATGAGGATTAGGG + Intergenic
1191694396 X:63974926-63974948 TTGCAGAAACATGAAGCTGGAGG + Intergenic
1194291825 X:92082739-92082761 TTACAGAAGCATTAACATGATGG + Intronic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197375784 X:125680592-125680614 TTCCAGAAACATGAAGATAATGG - Intergenic
1197975597 X:132162894-132162916 TTGTGGAAGCTTGAACATGAGGG + Intergenic
1198658219 X:138937926-138937948 CTGGAGCAGGATGTAGATGAAGG + Intronic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1200609341 Y:5307311-5307333 TTACAGAAGCATTAACATGATGG + Intronic