ID: 998234370

View in Genome Browser
Species Human (GRCh38)
Location 5:140385592-140385614
Sequence GGGGAGGTTGAAAACCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998234363_998234370 3 Left 998234363 5:140385566-140385588 CCAGAACCTAACAGCAAGGTCAA No data
Right 998234370 5:140385592-140385614 GGGGAGGTTGAAAACCTCTAGGG No data
998234365_998234370 -3 Left 998234365 5:140385572-140385594 CCTAACAGCAAGGTCAAAATGGG No data
Right 998234370 5:140385592-140385614 GGGGAGGTTGAAAACCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998234370 Original CRISPR GGGGAGGTTGAAAACCTCTA GGG Intergenic
No off target data available for this crispr