ID: 998244023

View in Genome Browser
Species Human (GRCh38)
Location 5:140479656-140479678
Sequence TGGGAATATACATGTATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998244023 Original CRISPR TGGGAATATACATGTATAAC AGG (reversed) Intronic
903110790 1:21131364-21131386 TGGTATAATATATGTATAACTGG + Intronic
903314790 1:22494503-22494525 TGAGAATCTACATATTTAACAGG + Intronic
908870276 1:68602650-68602672 TGGGTATATAAATATATAAATGG + Intergenic
909615465 1:77603665-77603687 TAGGAATCTACATTTTTAACAGG + Intronic
911461604 1:98198016-98198038 TGGGACTAGAGATGTATAACAGG - Intergenic
911650728 1:100385316-100385338 TGAGAATTTACATTTCTAACAGG - Intronic
917022140 1:170601344-170601366 TGGGTAAATACAGGTATTACAGG + Intergenic
918320297 1:183357887-183357909 TGGGAATATATAAATATAATGGG - Intronic
922942825 1:229482823-229482845 TGGGCTTATTCATGTATCACAGG - Intronic
923746010 1:236700846-236700868 TGGGAATTCACATCTTTAACAGG - Intronic
924307564 1:242706689-242706711 TTGTGATATACTTGTATAACAGG + Intergenic
924660269 1:246009460-246009482 TGTGAATATATATTTTTAACTGG + Intronic
1063388610 10:5633469-5633491 TGGAATTTTACATGTATAACAGG - Intergenic
1064649740 10:17496895-17496917 TGGTAATAGAAATGTATAAATGG + Intergenic
1065216773 10:23456667-23456689 GGGGAATTTACATCTATAACGGG - Intergenic
1067228774 10:44392488-44392510 TGGATATATAGATGGATAACTGG - Intergenic
1067287386 10:44916563-44916585 TGGGGATATACATGTAAGAGGGG - Intronic
1068187069 10:53599146-53599168 TGGGAAGATAAATGTGTAATCGG - Intergenic
1068620023 10:59172250-59172272 TTTGAATATATATGTATAATAGG + Intergenic
1069575030 10:69520824-69520846 TGGGAGTATACATCTAGAAGTGG + Intergenic
1071079433 10:81793251-81793273 GGGGCATATACATGTATATAGGG - Intergenic
1071884163 10:89931497-89931519 TGGGAAAATACATATATACAAGG - Intergenic
1074541294 10:114367299-114367321 TGGGAATTTAGATTTATATCAGG + Intronic
1075527837 10:123201108-123201130 TGGATATATAGATATATAACAGG - Intergenic
1084289935 11:68156269-68156291 TGGGAATATAAATCTGTAACAGG - Exonic
1084988487 11:72900145-72900167 TATGTATATACATGTATAAGAGG - Intronic
1087547999 11:99609030-99609052 TGGGAATAGTCATGTGAAACTGG - Intronic
1091059212 11:132445775-132445797 TGGGAGCATACATGTGTAACTGG - Intronic
1091220015 11:133925130-133925152 TGGGAAGAGATATGTACAACAGG + Intronic
1091987854 12:4927536-4927558 TGGCAATATCCAAGTATCACAGG - Intronic
1095635326 12:44426112-44426134 TGGGATAATATATGTGTAACTGG + Intergenic
1097127482 12:56786169-56786191 TGGGAATATACTTTTTCAACTGG - Intronic
1098384117 12:69900511-69900533 TGAGAATATGCATTTCTAACAGG + Intronic
1099133949 12:78870060-78870082 GGGGAATTTCCATGTAGAACGGG + Intronic
1099679575 12:85807668-85807690 TGTAAATATACATGTATATATGG + Intronic
1099791069 12:87334262-87334284 TGGCACTATACATGTATGAATGG - Intergenic
1101050683 12:100860492-100860514 TGGGAACATACATGTACACAAGG + Intronic
1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG + Intronic
1102537103 12:113589817-113589839 TGGGTATATAAATGGATAAGTGG - Intergenic
1103111623 12:118285043-118285065 TGGGAATATATATTTTTAAAAGG + Intronic
1106969263 13:35117132-35117154 GGGGATTATACATTTATAAATGG + Intronic
1107211555 13:37862363-37862385 TGGTAATATCTATGTATAAAAGG + Intronic
1108983525 13:56552323-56552345 GGGGTATATAAATTTATAACAGG - Intergenic
1109161251 13:58977550-58977572 GGGGAATAGCCATGTATAAAGGG + Intergenic
1109662487 13:65482056-65482078 TGTGATTTTACATGTAAAACTGG - Intergenic
1112868865 13:103943392-103943414 AGGATATATACATGTATAATAGG + Intergenic
1115727574 14:36234028-36234050 TGGTTATATACATGGAGAACTGG + Intergenic
1116126449 14:40794639-40794661 ATGGAATATACATGAAAAACAGG - Intergenic
1116354593 14:43912927-43912949 TGAGAATCTACATGTACTACTGG - Intergenic
1117823801 14:59678881-59678903 TGAGAATGTACATTTTTAACAGG + Intronic
1119848010 14:77845331-77845353 TGAGAAAATACATGTATAAAGGG + Intronic
1121195124 14:92065084-92065106 TGGGAATATAAATCGATAGCAGG - Intronic
1123483701 15:20663275-20663297 GGGGATTATACATTTATAAATGG - Intergenic
1126897152 15:53271308-53271330 TGGAAATATACATGAATATATGG - Intergenic
1127095411 15:55507948-55507970 TGGGAATTTGCATTTCTAACAGG - Intronic
1127818812 15:62637522-62637544 TGGGAAGATACATGAATTCCTGG - Exonic
1130415845 15:83694037-83694059 TGGGAAAATACATGCTTCACTGG + Intronic
1130538891 15:84807215-84807237 AGGGAATTTACATGTTAAACAGG - Intergenic
1133614778 16:7465777-7465799 CAGGAATATGCATTTATAACAGG + Intronic
1137069845 16:35894439-35894461 TGGGAGTTTACCTGTATAACTGG - Intergenic
1138827456 16:60337628-60337650 GGGCAATATAAATGTAAAACTGG + Intergenic
1139173648 16:64662242-64662264 TGGGAAAACACATATATAACGGG + Intergenic
1139190739 16:64860131-64860153 ATGGAATATAGATGTATTACTGG - Intergenic
1142516780 17:436279-436301 TGATAATATACATGTATCAAAGG - Intergenic
1147522271 17:41185034-41185056 TGGGAAAATATCTGTATAAAAGG + Exonic
1147959822 17:44160269-44160291 TGGTAATATTCATATATAGCTGG + Intronic
1150737151 17:67750803-67750825 AGGGTATATACATGTAAAACAGG - Intergenic
1156447174 18:37245745-37245767 TGTGTATATATATGTATATCTGG + Intronic
1157095599 18:44682971-44682993 TGGGAAAATAGATGTATCTCTGG + Intronic
1159171561 18:64775150-64775172 TGGGAATATATGTGTAAAATGGG + Intergenic
1163283203 19:16330002-16330024 TGACAATACAAATGTATAACTGG - Intergenic
1163703707 19:18800171-18800193 TGGGTATATAGATGAATAAGTGG + Intergenic
1166335146 19:42101427-42101449 TGGACATAGACATGGATAACGGG + Intronic
1167572922 19:50301206-50301228 TGGGAATCTGCACTTATAACGGG - Intronic
925504059 2:4541419-4541441 TTGAAATATACATGTAAGACAGG + Intergenic
927432340 2:23037474-23037496 TGGGAATAAACATTTTCAACTGG - Intergenic
930168882 2:48231153-48231175 TGGGGATATACATTGTTAACAGG + Intergenic
930392131 2:50774842-50774864 TGGGAATAGAAATGTATATGTGG - Intronic
932882294 2:75514613-75514635 TATGAATATACATATATAAATGG + Intronic
935150871 2:100434170-100434192 AGGGAATATACATTTATATCTGG + Intergenic
937244917 2:120486488-120486510 TGTGAATGTACATGTGTACCCGG + Intergenic
937453413 2:122021258-122021280 TGTGTATATACATATGTAACTGG - Intergenic
937543369 2:122986620-122986642 AGGCAATATACATTTATAAATGG - Intergenic
937587333 2:123568472-123568494 TGGAAATAAACATGTATTTCAGG - Intergenic
937648714 2:124296514-124296536 TGGGAGTGTACATGTATAAGAGG - Intronic
937701853 2:124871439-124871461 TGGGGAGAGACATGTATACCTGG - Intronic
941304292 2:163842377-163842399 TGGGGATAAACATGTATATCTGG + Intergenic
942724989 2:178996453-178996475 TGGGAAGTTACATGTTTACCTGG - Intronic
943714307 2:191133516-191133538 TGCATATATACATGTATAAGGGG + Intronic
943863957 2:192904224-192904246 TGGTAATACACCTGTATAAGAGG - Intergenic
945588740 2:211701389-211701411 TGGGCATTTACATGTTTAATCGG - Intronic
945833698 2:214813598-214813620 TGGGACCAAACATTTATAACTGG + Intergenic
1170779128 20:19407954-19407976 TGGGAGTAAACCTGTAAAACTGG + Intronic
1171225365 20:23438053-23438075 TGGTAAGGTACATGTATAAAGGG - Intergenic
1173936015 20:46865342-46865364 TGAAAATATACATGTAAAATGGG - Intergenic
1177399680 21:20586787-20586809 TGGGTATATATATATATATCTGG - Intergenic
1177399781 21:20587819-20587841 TGGGTATGTATATGTATACCTGG + Intergenic
1178728300 21:35075266-35075288 TGGGAATTTACAAAAATAACGGG - Intronic
1181532610 22:23525515-23525537 TGGTTATATACATGAATACCGGG + Intergenic
1182171379 22:28233553-28233575 TTGGAATACATATGTCTAACTGG - Intronic
1182409418 22:30170506-30170528 GGGGAATTTACATTTTTAACAGG + Intronic
1183144603 22:35978336-35978358 TGGAAATATAGATGTATATGTGG + Intronic
949248486 3:1954031-1954053 ATAGAATATACATGTATAACAGG + Intergenic
950158454 3:10741537-10741559 TGAGAATATGCATTTCTAACAGG + Intergenic
951333769 3:21396719-21396741 TTGGAATATATATATATATCAGG - Intergenic
952136043 3:30421251-30421273 TTGGAGTATACATGTAAAAGTGG + Intergenic
952156670 3:30650760-30650782 TGAGAATCTGCATTTATAACAGG - Intronic
956931786 3:74051864-74051886 TCATATTATACATGTATAACTGG - Intergenic
957896709 3:86430024-86430046 TAGGAAAATACATATATAAAGGG - Intergenic
959249757 3:103926836-103926858 TGGTAATATTAATGTTTAACCGG + Intergenic
959952745 3:112198788-112198810 TGTGTATTTACAAGTATAACAGG + Intronic
962101623 3:132348711-132348733 TCTGAATGTACATGTCTAACAGG - Intronic
963668552 3:148222090-148222112 TGGAAATATAAATGGATAAGTGG - Intergenic
963785780 3:149533085-149533107 TGTGAATATACATGTTTAACTGG - Intronic
964700500 3:159560647-159560669 TGGGAATTTACATGAAGAAATGG - Intronic
966211323 3:177456434-177456456 TTGGAAAATAGATGTATCACAGG + Intergenic
970534230 4:17012702-17012724 TGGGAATTTAAATGTCTAAGAGG - Intergenic
971912735 4:32815541-32815563 TGTGGGTATATATGTATAACAGG + Intergenic
973138650 4:46737988-46738010 TGGGAAGATTCATGACTAACAGG - Intronic
973240093 4:47947713-47947735 TAAGAATATACATGTGTAAAAGG + Intronic
976143363 4:82016387-82016409 TGTGAATATTCATGTACAAATGG - Intronic
977035795 4:91951513-91951535 TAGGAAAATACATGTATTCCTGG - Intergenic
977328911 4:95611922-95611944 TGGGAATATAACTGTATCAGAGG - Intergenic
977341140 4:95760240-95760262 TGAGAATACAAATGTCTAACTGG + Intergenic
977483686 4:97614053-97614075 TGTGTATATACTTGTATACCAGG + Intronic
978382964 4:108149650-108149672 TGTGTATATATATATATAACTGG + Intronic
978553767 4:109956655-109956677 TGTAACTATACATGTATAATTGG + Intronic
981256459 4:142666146-142666168 TGTGTATATATATGTATAAATGG + Intronic
982551561 4:156807707-156807729 TGGGACTATAAATGGATATCGGG - Intronic
982617378 4:157656645-157656667 TGGAAATATTGATGTTTAACTGG - Intergenic
986119696 5:4821592-4821614 TGGGAATAAAAATAAATAACAGG - Intergenic
988203918 5:28109287-28109309 TAGGAAAATACAAGTATAACAGG - Intergenic
989365163 5:40647708-40647730 TGGAGATATACATGTATATGTGG - Intergenic
989685405 5:44080667-44080689 TGGGAATATATATATTTAAATGG + Intergenic
990788674 5:59452193-59452215 TGTGAATATAAATGTATCAATGG - Intronic
990806521 5:59668983-59669005 TTGGAATATACATGCATATTTGG + Intronic
994265721 5:97713890-97713912 AGGGAATGTACATTTATGACAGG + Intergenic
994786724 5:104174628-104174650 TGTGAATATACATTTAGAATTGG - Intergenic
996216526 5:120873522-120873544 AGGGAATATACTTGTATACTTGG - Intergenic
996316001 5:122161357-122161379 TGGGAACATAAAGGTATCACTGG + Intronic
998244023 5:140479656-140479678 TGGGAATATACATGTATAACAGG - Intronic
999470618 5:151851527-151851549 TGGGAATATACATCTGAATCAGG + Exonic
1000266081 5:159639722-159639744 GGAGAATATCCATGTATAAGTGG + Intergenic
1001430194 5:171654776-171654798 TGGGAATATAGGAGTATATCTGG + Intergenic
1002100396 5:176854822-176854844 TGGGAAGACACATGCATAAATGG + Intronic
1004321696 6:14636249-14636271 TGGAAATAAACATGTACAAAAGG + Intergenic
1004945564 6:20609085-20609107 TGGGAATATAGCAGAATAACTGG + Intronic
1005835515 6:29705798-29705820 TGGGGATATGCTTGAATAACAGG - Intergenic
1007158044 6:39765045-39765067 TGGGATTGAAAATGTATAACTGG - Intergenic
1008328689 6:50219063-50219085 AGGGAATATACATTTCAAACAGG + Intergenic
1009463850 6:63947545-63947567 TAGGAATTTACATATATAATTGG + Intronic
1010064035 6:71659366-71659388 TGACAATATAATTGTATAACTGG - Intergenic
1011774827 6:90717950-90717972 TTGGAAAATACATGAATAATAGG + Intergenic
1012744860 6:103073235-103073257 TGGGACTATACAAATATAACAGG + Intergenic
1016215961 6:141603304-141603326 TTTGAATGTACATGTATAATAGG - Intergenic
1016646073 6:146409959-146409981 TGAGAATATATTTTTATAACTGG - Intronic
1017962994 6:159238473-159238495 GGGGTATATACATATATAATTGG + Intronic
1018883417 6:167908309-167908331 TGAGTCTACACATGTATAACTGG - Intronic
1020658057 7:10950981-10951003 TGGTAAGATACATGTAGGACAGG - Intergenic
1023265163 7:38397196-38397218 TTGGAACATATATGTATAAAAGG - Intronic
1024247075 7:47478689-47478711 TGTGAATATATATGTATATTAGG - Intronic
1025156747 7:56613891-56613913 TGGGGATTTAGATGTATCACTGG - Intergenic
1025291127 7:57724788-57724810 TGGAAATATCCCTGTATAAAAGG + Intergenic
1026343418 7:69453549-69453571 TGGGAATGTGTATGTTTAACTGG - Intergenic
1026363236 7:69622357-69622379 AGGGAATATACATTTGAAACAGG + Intronic
1027794998 7:82681373-82681395 TGAGAAAATAAATGTACAACTGG + Intergenic
1028162667 7:87503702-87503724 TGTGAATAGACATATACAACAGG + Exonic
1028906470 7:96160040-96160062 TCAAAATACACATGTATAACAGG - Intronic
1030803968 7:113890325-113890347 TGGGAATCTGCATTTTTAACTGG + Intronic
1030803975 7:113890413-113890435 TGGGAATCTGCATTTTTAACTGG + Intronic
1033053317 7:138026938-138026960 TGGAAATATTCATGAATACCTGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036056865 8:5265001-5265023 TGGCAATACACATATATATCAGG - Intergenic
1038998497 8:32952890-32952912 AGGGAATATACTTGTATTGCAGG + Intergenic
1041594150 8:59626811-59626833 TTGCAATAAAGATGTATAACAGG + Intergenic
1045073308 8:98534133-98534155 TCAGAATATACATGTATTAGTGG + Intronic
1045284617 8:100779641-100779663 TGGGAATCTACATTTTGAACAGG - Intergenic
1047584922 8:126260789-126260811 AGGGTATATACATGTAAAATAGG + Intergenic
1048103884 8:131386102-131386124 TGGGGAGATACATGTATAAATGG + Intergenic
1048624029 8:136164688-136164710 TGAGACAATGCATGTATAACGGG - Intergenic
1050403622 9:5283703-5283725 TGGGAATATTCAAAGATAACAGG + Intergenic
1051428211 9:16955755-16955777 AGGGAATATAAATGAATAAAAGG - Intergenic
1052383681 9:27799969-27799991 TGGGTATATACATTTGTAAATGG + Intergenic
1052680543 9:31685948-31685970 TGGGAAAATACATGGAAAAGGGG - Intergenic
1053180578 9:35965039-35965061 CGGGAATATGTATGTATACCAGG - Intergenic
1055004321 9:71488349-71488371 TGGGCACATTCATGTATAAGGGG + Intergenic
1056548942 9:87635680-87635702 AGGTAATAGACATGTGTAACTGG - Intronic
1056734211 9:89191612-89191634 TGAGAAGATAAATGTAGAACAGG + Intergenic
1058751353 9:108041343-108041365 TAGGAATAAACATGTAGAGCTGG + Intergenic
1060678490 9:125538962-125538984 GGGGAGTAAACATGTACAACAGG - Intronic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1187325904 X:18287708-18287730 TGGGGATATAATTATATAACAGG - Intronic
1188884730 X:35535699-35535721 TGTGACTATAAATGTCTAACTGG - Intergenic
1189072654 X:37880963-37880985 TGGATATATACAAGTATAAAAGG + Intronic
1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG + Intergenic
1192752469 X:74008215-74008237 TGGGAATTTACATGTGTGTCAGG - Intergenic
1197310894 X:124903994-124904016 TGGAAATACACAAGTATACCTGG - Intronic
1198207267 X:134478908-134478930 TGGCAATTTACATTTATAACTGG - Intronic
1198420623 X:136468074-136468096 GGGGAATATACATATATATGGGG + Intergenic
1201637625 Y:16142922-16142944 AGGGAAAATAAATGTATAAGAGG + Intergenic