ID: 998244431

View in Genome Browser
Species Human (GRCh38)
Location 5:140485705-140485727
Sequence ACTGATCTTGAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998244431_998244436 -4 Left 998244431 5:140485705-140485727 CCCTCCACCTTCTCAAGATCAGT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 998244436 5:140485724-140485746 CAGTCTCAGGTAAAGTAAAATGG 0: 1
1: 0
2: 1
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998244431 Original CRISPR ACTGATCTTGAGAAGGTGGA GGG (reversed) Exonic
900732583 1:4271949-4271971 ACTGCAGTTGAGAAGGTGGAAGG - Intergenic
901791454 1:11655346-11655368 TGAGATCTTGAGAAGGTGGCTGG + Exonic
901831321 1:11894330-11894352 ACTGATCTTGCAAGGATGGATGG + Intergenic
902988017 1:20167363-20167385 ACTGAGCTTGTGAAGATGGGGGG - Intronic
904901972 1:33864876-33864898 ACTGATCCTGAGGAGGGGAACGG + Intronic
905248544 1:36631185-36631207 ACTGATCTTGAGAAGACAGAAGG - Intergenic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
910264210 1:85321501-85321523 TCTGAACTGGAAAAGGTGGATGG - Exonic
912270266 1:108200960-108200982 ACCCATCTTGAGAAGGAGGAGGG - Intergenic
912273727 1:108235257-108235279 AGTGATCTTGAAGAGGTGAAAGG - Exonic
912294493 1:108459066-108459088 AGTGATCTTGAAGAGGTGAAAGG + Exonic
912406281 1:109440828-109440850 ACTGATATGGAGAAGGCTGAAGG - Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
916559843 1:165925197-165925219 ACTGAGACTGAGAGGGTGGATGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918762427 1:188428875-188428897 AATGATCTTGAGAAGAAGGAGGG - Intergenic
919031552 1:192249763-192249785 AATGACTTTGAGAAGGTGAAAGG - Intergenic
919474167 1:198013965-198013987 AATGATCTGGACAAGGTAGAGGG + Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
922333812 1:224602059-224602081 GTTGATCTTATGAAGGTGGAAGG - Intronic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
923163364 1:231337234-231337256 ACCCTGCTTGAGAAGGTGGAAGG - Exonic
923163730 1:231339512-231339534 ACCCTGCTTGAGAAGGTGGAAGG - Intronic
923463031 1:234223708-234223730 ACTGTGCTTGAGAAGGTGTAAGG - Intronic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1064064476 10:12169264-12169286 AGTGAAGTTAAGAAGGTGGAAGG + Intronic
1065964799 10:30762435-30762457 CCAGACCTTGAGAAGGTGGGAGG - Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1071478993 10:86048875-86048897 ACTGAGCTTCAGAAAGGGGAAGG - Intronic
1076415890 10:130288234-130288256 AATGAACTGGAGCAGGTGGAAGG + Intergenic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1086411422 11:86548407-86548429 ATAGATCTTAGGAAGGTGGAAGG - Intronic
1086632923 11:89045720-89045742 ACTGATCTTCTGAAGCTAGAAGG + Intronic
1089023102 11:115238675-115238697 AGTGATTGTGAGAAGGTGGACGG + Intronic
1089883358 11:121795785-121795807 AGTGGTCTTGGGAAGGGGGATGG - Intergenic
1090617537 11:128529222-128529244 ATTAAACTTGAGAAGGTGAAAGG - Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1094471734 12:30807860-30807882 ACTGATCTTAATAAGATGGCAGG + Intergenic
1096055199 12:48644925-48644947 ACTGTTCTTGAGAATGGAGATGG + Intergenic
1101741805 12:107506233-107506255 AATAATCTTGAATAGGTGGAGGG + Intronic
1101842453 12:108337945-108337967 ATTGGTCTTGAGAAGGAGGTAGG + Intronic
1102245443 12:111353016-111353038 ACAGCTCTTGAGAAGGTTGGAGG + Intergenic
1102647254 12:114411868-114411890 AATGATCTTGAGGAGGTGAAGGG + Intergenic
1104806642 12:131593444-131593466 ACTGGTCTAGGGAAGGTGCAGGG + Intergenic
1104842015 12:131829952-131829974 AAGGGTCTTGAGGAGGTGGAGGG - Intronic
1107063539 13:36187615-36187637 ACTAATCTTCAGCAGATGGAGGG + Intronic
1107146342 13:37064594-37064616 ACTAATCTTGATAATGTGGGTGG - Intergenic
1110024161 13:70512603-70512625 ACTTTTCTTGAGAGGATGGAAGG - Intergenic
1110611356 13:77491584-77491606 GCAGATGTGGAGAAGGTGGAGGG + Intergenic
1112702123 13:102021964-102021986 ACTGATCTTGAGAACTGGAATGG - Intronic
1113271338 13:108678296-108678318 AATGATCTTGAGAAGGTCAGAGG - Intronic
1114746677 14:25155897-25155919 ACTGGTATAGGGAAGGTGGAGGG - Intergenic
1116339913 14:43709254-43709276 AATGGTCTTCACAAGGTGGAAGG - Intergenic
1117042915 14:51783908-51783930 ACTCATTTGGAGAAGATGGACGG + Intergenic
1117983091 14:61361140-61361162 ACTGATCTGAACAAGGTTGAGGG - Intronic
1118879242 14:69811941-69811963 ACTGAAATTGAGAAGGTGAACGG + Intergenic
1121688871 14:95860288-95860310 ACAGAGCTTGAGAACTTGGAAGG - Intergenic
1125685335 15:41560088-41560110 ACTGGTCCTGAGAGGGTGAAGGG + Intronic
1125707761 15:41755302-41755324 ACTGATGCTGAGAAAGTTGAAGG + Intronic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129333163 15:74838123-74838145 ACTGAGCTTGAGAGGGTTGGGGG - Intronic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1129971113 15:79778876-79778898 ATTTACCTTGAAAAGGTGGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131802801 15:96089367-96089389 AATGATCTTGGGAAGAAGGAGGG - Intergenic
1131859824 15:96640655-96640677 ACTGACCTTGATAATGTGGGTGG + Intergenic
1134036503 16:11035443-11035465 ACATAGCTTGGGAAGGTGGAGGG + Intronic
1134829313 16:17310503-17310525 ACTGACCCTGAGTAGGAGGAGGG - Intronic
1135038308 16:19096911-19096933 TCTGATCTGGAAAAGGTGGCTGG - Intergenic
1137367663 16:47874557-47874579 ACTGATTTTGTGGAGGTGGTAGG + Intergenic
1139580311 16:67869393-67869415 ATAGGTCTTGAGAAGGAGGAAGG - Intronic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1145233764 17:21194162-21194184 ACTGTTCTTGAGGAGGAGGTTGG + Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146484932 17:33235245-33235267 CCTGATCCTGGGAAGGGGGAGGG - Intronic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1149969774 17:61205337-61205359 ACTGATGTTGACAATGTGGGAGG - Intronic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1150531199 17:65983643-65983665 ACTCATGGTTAGAAGGTGGAGGG - Intronic
1158949873 18:62484210-62484232 AATGATCTTGAGCTGGTGGATGG - Intergenic
1159138807 18:64368414-64368436 ACTGAGACTGAGAAGGTGGTGGG - Intergenic
1159804639 18:72941378-72941400 ATTGTTCCTGAGAAGCTGGAAGG + Intergenic
1160085731 18:75776111-75776133 ACAGATGCTGAGAAGGTTGAAGG - Intergenic
1161760221 19:6165754-6165776 AATGATCCTCAGCAGGTGGAAGG - Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1163732286 19:18956012-18956034 AGGGAGGTTGAGAAGGTGGATGG + Intergenic
1164549067 19:29193118-29193140 ACTGAACTTGAGAAGGAGCTGGG - Intergenic
1168062839 19:53903056-53903078 AATGATCTAGGGGAGGTGGAAGG - Exonic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925738569 2:6985462-6985484 ACTGATAATGAGTAAGTGGAAGG + Intronic
926980784 2:18565534-18565556 GCTGCTCTTGAGAAGTTTGAGGG + Intronic
929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG + Intergenic
929973887 2:46612022-46612044 GCTGATCTTGCTAACGTGGAGGG + Intronic
932427015 2:71644347-71644369 CCTGATCTTGGGAAGGGGTAGGG - Intronic
934686032 2:96322250-96322272 AGTGATCTTCTGAGGGTGGAGGG - Intergenic
936959775 2:118061010-118061032 ACTGGTATTCAGCAGGTGGATGG + Intergenic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
941432297 2:165427073-165427095 ACTGATCCTGGGAAGGAGGTGGG + Intergenic
941585756 2:167356153-167356175 ACTGCTCTTGATTAGGTGGTAGG + Intergenic
943292985 2:186099389-186099411 ACAGATATTGAGATAGTGGAAGG - Intergenic
1169535712 20:6537756-6537778 ACTGCTCCAGAGAAGGTGGTGGG + Intergenic
1171475111 20:25402690-25402712 ACTGAAATTGACAAGGTGAACGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175624356 20:60478103-60478125 ACTCGTCATGAGAATGTGGAAGG + Intergenic
1178183404 21:30190906-30190928 AGTGATCTAGAGAAAGGGGAAGG + Intergenic
1178546084 21:33494013-33494035 ACTGGTATTGGGAAGGAGGATGG - Intergenic
1180926282 22:19557305-19557327 ACTGACCTGATGAAGGTGGAGGG + Intergenic
1184255226 22:43282630-43282652 ACTGATGGAGAGAAGGTGGGTGG - Intronic
1184541729 22:45130396-45130418 GCAGTTCTTGAGAAGGTGGGAGG - Intergenic
949180634 3:1126137-1126159 ACTGATTTTGAGAAAGTTGCTGG + Intronic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
959960570 3:112293709-112293731 GCTGATCTTGAGCTGGAGGAAGG - Intronic
961096263 3:124159172-124159194 ACTGAATTTGAGCAGATGGAGGG - Intronic
961442831 3:126962897-126962919 GCTGGTCTTGAGAAGCTGGCAGG - Intergenic
962650548 3:137484578-137484600 TTTGATCTTGTGAAGGTAGAGGG - Intergenic
964230696 3:154463789-154463811 ACTTATGATGGGAAGGTGGAAGG - Intergenic
964915031 3:161830123-161830145 ACTTGTCTTGAGGAGGTGGGAGG - Intergenic
966240279 3:177748127-177748149 ACTGATCTGGGGATGATGGAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
969383864 4:6829486-6829508 ACTGATTTTTAAAAGATGGAAGG - Intronic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
976048001 4:80976072-80976094 AGTGATCTTGATAAAGTGCATGG - Intergenic
977266890 4:94866182-94866204 AGAGAGCTTGAGAAGATGGATGG - Intronic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
983503242 4:168524624-168524646 ACAGATCTTGAGAAGGGTTATGG - Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985149130 4:186928467-186928489 ACTGCAGTTGAGAAGCTGGATGG - Intergenic
987052837 5:14162418-14162440 ACTGACCTTGAGAACATTGAAGG + Intronic
987166668 5:15205066-15205088 TCTTATCCTGAGAAGCTGGATGG - Intergenic
991692554 5:69239216-69239238 AATGATGTTGAGAATGTGGTGGG - Intronic
993306845 5:86284837-86284859 AATGATCTTGAAGAGGTGAAAGG + Intergenic
993780168 5:92056532-92056554 AATGTTCTTCAGAAGGTGAAAGG - Intergenic
996133900 5:119815308-119815330 ACTGATGATGAGCAGCTGGAGGG - Intergenic
997258970 5:132450968-132450990 ACCTATCTTGTGAAGTTGGAAGG + Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
1002462617 5:179382945-179382967 GGTGATGTTGAGAAGGTGGGTGG - Intergenic
1002853588 6:1018391-1018413 ACTGTTCTTGTAAATGTGGATGG - Intergenic
1003131031 6:3395408-3395430 GCTGATCTTTACAAGATGGATGG - Intronic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1006673035 6:35741893-35741915 ACTGCACTTGAGAAGGCTGAGGG - Intronic
1007186441 6:39976178-39976200 TCTGAGTTTGATAAGGTGGAAGG + Intergenic
1008486963 6:52046935-52046957 AATGCTCTTGAGTAGGTAGAAGG - Intronic
1008738368 6:54574870-54574892 ACTGAACTTGAAAAACTGGATGG - Intergenic
1009951834 6:70406041-70406063 ACTGTGCATGAGAAGGTAGAAGG + Intergenic
1011528592 6:88295142-88295164 AGAGTTCTTGAGAAGGTGGTAGG + Intergenic
1013671535 6:112408709-112408731 ACTGCTCTTGGGAACATGGAAGG - Intergenic
1015476174 6:133660889-133660911 AATGACCTTGAGGAGGTGGATGG - Intergenic
1016360301 6:143260354-143260376 ACTGAACTGAAGAAGTTGGATGG - Intronic
1019843958 7:3477839-3477861 ACGTATCATGAGAAGTTGGATGG + Intronic
1020954447 7:14722865-14722887 GCTGATCTTGGGGAGGTGGTAGG - Intronic
1021685159 7:23178255-23178277 AATCATCTTGGGAAGGAGGAAGG - Intergenic
1023669052 7:42556839-42556861 ACTGAACTAGACAATGTGGAGGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024286610 7:47763252-47763274 TCTGTACTTGAGTAGGTGGAGGG - Intronic
1024325982 7:48109556-48109578 CTAGAGCTTGAGAAGGTGGAAGG - Intergenic
1029313979 7:99694607-99694629 ACTGACCTAGAAAAGGTGGCGGG + Intronic
1030164192 7:106536446-106536468 ACTGATGGTGTGAAGATGGAGGG + Intergenic
1030764508 7:113392557-113392579 ACTGATTTTGTGGAGGTGGCTGG + Intergenic
1030888295 7:114965520-114965542 ACTGATGTTGACCAGGTAGACGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1032484787 7:132277306-132277328 ACTGATTTAGGGAAGGTGGGAGG - Intronic
1032636618 7:133716001-133716023 ACTCTGCTGGAGAAGGTGGAAGG + Intronic
1034919085 7:155064597-155064619 ACTGATTATGAGGAGGTGGCAGG - Intergenic
1036603155 8:10281969-10281991 AGTGTTCTTTCGAAGGTGGAGGG + Intronic
1038442502 8:27581801-27581823 ACTGACCTTGAGGAGCTGGAAGG - Intergenic
1038771016 8:30480049-30480071 ACTAAGTTAGAGAAGGTGGAAGG + Intronic
1039920183 8:41888226-41888248 ACTGAGCTTGGGAAAGAGGAGGG - Intronic
1044424638 8:92037234-92037256 GCTGATGTTGAGAAGGAGGGAGG + Intronic
1045387482 8:101685850-101685872 TCTGATCCTGAGAAGGTGGCTGG - Intergenic
1045611453 8:103847656-103847678 ACTGGCCTTTACAAGGTGGAAGG + Intronic
1046308922 8:112408173-112408195 AGTGATCTAGTGATGGTGGAGGG + Intronic
1047185336 8:122627947-122627969 AGCCATCTTGAGAAGCTGGATGG - Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1048367169 8:133748244-133748266 ACAGATGTTGAGCAGGTAGAAGG - Intergenic
1050163244 9:2739546-2739568 ACAGATGGTGAGAAGGTGAAGGG + Intronic
1052851584 9:33381508-33381530 ACTGAGCGTGAGAGGGGGGAAGG + Intergenic
1052857114 9:33414372-33414394 ACGCATCATGAGAAGGAGGAAGG + Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1056809773 9:89755160-89755182 ACTGATGTTGAGAAGGGCTAGGG - Intergenic
1057452308 9:95175694-95175716 ACTGAACTTGCGAAGGCGGAGGG + Intronic
1058903147 9:109459417-109459439 ATGGAACTTGAGAAGTTGGAGGG - Intronic
1059338486 9:113583842-113583864 GCAGATCTTGACAGGGTGGAAGG - Exonic
1062128470 9:134879793-134879815 ACTGATCTTGCCAAGGAAGAAGG + Intergenic
1062129312 9:134883963-134883985 AGTGGTCTTGAGAGGGTGGGGGG + Intronic
1185587127 X:1248524-1248546 ACTTTTCTTGTGGAGGTGGAGGG + Intergenic
1189506501 X:41616373-41616395 ACTGAGCTTCAGAAGGTTCATGG + Intronic
1190036636 X:47031403-47031425 GCTGAGCTTGAGTAGGTGGTTGG - Intronic
1190799571 X:53775053-53775075 ATTGACCTAGAGAAGATGGAAGG + Intergenic
1192225488 X:69224508-69224530 AGAGAGCTTGAGAAGGTGGCAGG - Intergenic
1197125979 X:122946730-122946752 CCTGATCCTGAGAAGTTGCATGG + Intergenic
1199398236 X:147366159-147366181 ACAGATCTTGAGAAGTAGGTAGG + Intergenic
1199574149 X:149297166-149297188 ACTCATCTTGTGAAGGGGAAGGG + Intergenic
1200239720 X:154487093-154487115 ACTGAGCTTGAGAGGGGGCAGGG + Intergenic
1200413736 Y:2887135-2887157 ACTGAAATTGACAAGGTGAAGGG - Intronic