ID: 998245339

View in Genome Browser
Species Human (GRCh38)
Location 5:140497087-140497109
Sequence CCCATTAGAACCTAAGTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998245339_998245342 27 Left 998245339 5:140497087-140497109 CCAGTGACTTAGGTTCTAATGGG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 998245342 5:140497137-140497159 TCAGGTAATCAGCAGATTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 138
998245339_998245341 9 Left 998245339 5:140497087-140497109 CCAGTGACTTAGGTTCTAATGGG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 998245341 5:140497119-140497141 CTTGAACTTCAGAAAGTATCAGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998245339 Original CRISPR CCCATTAGAACCTAAGTCAC TGG (reversed) Exonic
901778640 1:11577815-11577837 TCCACTAGAATCTAAGTCCCAGG + Intergenic
903645861 1:24896190-24896212 ATCATTAGCACCAAAGTCACAGG - Intergenic
904053963 1:27658118-27658140 CCCATTAGAATGTAAGTTATCGG - Intergenic
905743746 1:40395126-40395148 CCCATTCAAAGCTATGTCACTGG - Intronic
908789254 1:67765470-67765492 CACATTAGAAGCTAAGTAATTGG + Intronic
909787027 1:79626428-79626450 CCCATTTGAACATGTGTCACTGG - Intergenic
916273148 1:162965973-162965995 CCCACTAGAACATAAGTTTCAGG - Intergenic
917197084 1:172478107-172478129 CCCAGTAGTACCTACCTCACAGG + Intergenic
1065413587 10:25459673-25459695 CCCAGAGGAAGCTAAGTCACTGG - Intronic
1070030359 10:72670772-72670794 CCCGTTGTAACCAAAGTCACTGG + Intergenic
1070106124 10:73433026-73433048 TAAATTAGAGCCTAAGTCACTGG - Intronic
1073716472 10:106114132-106114154 CCCAGTAGATTCTAAGTCATTGG - Intergenic
1079376905 11:19901183-19901205 CCCATGAGATCTTAAGGCACTGG + Intronic
1079705079 11:23605526-23605548 CCCAGTGGAACTTAAGTCAGGGG + Intergenic
1086983001 11:93219149-93219171 CCCTTTACAACCTAATTAACCGG - Intergenic
1088672577 11:112157499-112157521 CCCACTAGACTCTGAGTCACTGG - Intronic
1089440253 11:118509940-118509962 CCTATTAGAACCTAAAACAGTGG + Exonic
1101467535 12:104962964-104962986 CCCACTGAAATCTAAGTCACAGG - Intergenic
1102536219 12:113583407-113583429 TCCCTTGGAACCAAAGTCACTGG - Intergenic
1104687406 12:130796528-130796550 CACTTTAGAAGCTAAGTTACAGG + Intronic
1106283119 13:28295225-28295247 GACATTAGAACCTAACACACTGG - Intronic
1110433241 13:75450632-75450654 CCCACCAGAACCTAAGTGTCTGG + Intronic
1110830938 13:80030135-80030157 CCCATTTAATCCTCAGTCACTGG + Intergenic
1113684824 13:112275767-112275789 CTCATTAGAATCTAAGTACCAGG + Intergenic
1119603441 14:75993740-75993762 ACCATGAGAACAAAAGTCACAGG - Intronic
1120347408 14:83308365-83308387 TCCACTAGAATCTAAGTCAGTGG - Intergenic
1139118675 16:63988396-63988418 CCTATTAGAAACTAAAACACAGG - Intergenic
1152946636 17:83201239-83201261 GCCATCAGACCCTAAGTCTCAGG - Intergenic
1153600177 18:6773252-6773274 CTCATTGGCACCTAGGTCACAGG - Intronic
1154261600 18:12839270-12839292 CCCTTAACAACCTGAGTCACAGG + Intronic
1157949565 18:52019445-52019467 CCCATGAGAACTGGAGTCACAGG + Intergenic
1157967293 18:52222635-52222657 CTCATTACAACCTGAATCACCGG + Intergenic
1160410027 18:78668958-78668980 CCCGTTAAAACCTAAGTCCTTGG + Intergenic
1168256079 19:55166102-55166124 CCCCTTAGAACCTAGGCCACGGG - Intronic
928123227 2:28598903-28598925 CCTATTACAACCTTCGTCACAGG - Intronic
932294877 2:70616024-70616046 CCCTTTACAAACTGAGTCACCGG - Intronic
933466429 2:82658011-82658033 CCCATAAAAACCCAAGGCACTGG + Intergenic
935233357 2:101118177-101118199 CCCATTAGAACCCAGGGCTCTGG - Intronic
940186214 2:150986848-150986870 CCCATTAGCAGCTCAGTCCCAGG - Intergenic
942515754 2:176751106-176751128 CCCATTACACCATATGTCACAGG - Intergenic
946613990 2:221489666-221489688 CCCATTAGAACATAAGCTCCAGG + Intronic
947140948 2:227018814-227018836 CCCATGAAACCCTAAGTCAGGGG + Intronic
1169453628 20:5733255-5733277 CTCATTAAAACATAGGTCACTGG - Intergenic
1170797367 20:19560611-19560633 CCCATTAGATCCACAGTCAGAGG + Intronic
1174884116 20:54312760-54312782 CCCACTAGAAGCTAGGACACAGG + Intergenic
1177249403 21:18572594-18572616 CCCATTAGAACCTTAGTTTTTGG - Intergenic
1183015005 22:34978941-34978963 CCTATTAGAACCTAACTCACTGG - Intergenic
1183463737 22:37968554-37968576 CCCATTAGAACCTCAGGCAGAGG - Exonic
953843758 3:46410513-46410535 CTCATTAAAACCCAAGTCTCTGG + Intronic
956784394 3:72630362-72630384 CCCATTACATCCTAAGGCAGAGG - Intergenic
956970984 3:74524864-74524886 ACCATGAGCACCTAAGCCACAGG - Intergenic
962918188 3:139927542-139927564 CCCAATAGAACCTAAATTGCAGG - Intergenic
965763516 3:172106443-172106465 CCCATCAGAACCAAACCCACCGG - Intronic
966730419 3:183146436-183146458 CCCATTAGGGCAGAAGTCACAGG + Intronic
974018495 4:56672048-56672070 CCAATTATATCCTGAGTCACTGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
975798264 4:78032167-78032189 CCCATTAAACCCTATGTCTCAGG - Intergenic
976785596 4:88816654-88816676 CCCATTAGAAGCTTAGTAAAGGG - Intronic
981107251 4:140895077-140895099 CCCACTAGAGACTAAGTCCCAGG + Intronic
981906490 4:149927022-149927044 CCCATTAGAACCTACTTCCTTGG + Intergenic
985801128 5:2005815-2005837 CCCATTTGAACCTCACTCCCAGG - Intergenic
989795581 5:45467268-45467290 CACATCAGAACCTAAGACATTGG - Intronic
994724251 5:103416014-103416036 CCAATTAGAACCTATGTGCCTGG + Intergenic
996770800 5:127083401-127083423 CGCCTTAAAACCTAAGTAACTGG + Intergenic
997786090 5:136715338-136715360 CTCATTAAAATATAAGTCACTGG - Intergenic
998245339 5:140497087-140497109 CCCATTAGAACCTAAGTCACTGG - Exonic
1002946157 6:1763348-1763370 CCCTTGAAGACCTAAGTCACTGG - Intronic
1004865113 6:19845759-19845781 CCCATCACAACCTACGTCAGTGG - Intergenic
1006717181 6:36128096-36128118 CCCATGAGAGCCTAAGGAACGGG - Intronic
1007237192 6:40399192-40399214 CACATTAGGATCTTAGTCACTGG + Intronic
1007262295 6:40572218-40572240 CCCATGACAACCTAAGGCACAGG - Intronic
1011503353 6:88014493-88014515 ACCATTTGAAACAAAGTCACTGG + Intergenic
1014248757 6:119094916-119094938 CCCATTAGAACCCCAGCCAGTGG - Intronic
1015118578 6:129676355-129676377 ACCATTAGAACCTACATCACAGG + Intronic
1015486015 6:133770765-133770787 CCCCTCAGCACCTAATTCACTGG - Intergenic
1021239875 7:18187257-18187279 GCCAGTAAAACCTATGTCACAGG - Intronic
1022637528 7:32150977-32150999 CCCATTCAAACCTAGGTCTCTGG + Intronic
1024665937 7:51547199-51547221 CCCATTTGAGCCTATGCCACTGG - Intergenic
1027044887 7:74984653-74984675 CCCATAGGAACCTGAGTCAAGGG - Intronic
1029387969 7:100256268-100256290 CCCATAGGAACCTGAGTCAAGGG + Intronic
1029395390 7:100304749-100304771 CCCATCAGCACCAAAGCCACTGG + Intergenic
1036434387 8:8719975-8719997 CCCTTTAGAATATGAGTCACAGG + Intergenic
1041119577 8:54572296-54572318 CCCATAAGAACCCCAATCACAGG + Intergenic
1047007083 8:120631549-120631571 CCTATTAGAAAGTGAGTCACTGG + Intronic
1049769524 8:144373472-144373494 CCCATAAGAAGCTAAGTGACAGG + Intronic
1053427035 9:38016970-38016992 CCCATGAGAACCTGAGTATCTGG + Intronic
1056615634 9:88163135-88163157 CCCATAGGAGCATAAGTCACAGG + Intergenic
1062326615 9:136015443-136015465 CCCATGAGGACCGAAGTCCCTGG + Intronic
1188131649 X:26441701-26441723 TTCATTAGAACCTCAGTCATTGG + Intergenic
1198261062 X:134965260-134965282 GCCATTAAACCCTGAGTCACAGG + Intergenic