ID: 998251963 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:140559440-140559462 |
Sequence | GGAGCCCGAGAGTGAAGTCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
998251963_998251969 | 25 | Left | 998251963 | 5:140559440-140559462 | CCCTGACTTCACTCTCGGGCTCC | No data | ||
Right | 998251969 | 5:140559488-140559510 | ACTCATCACCCTGACCTATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
998251963 | Original CRISPR | GGAGCCCGAGAGTGAAGTCA GGG (reversed) | Intronic | ||