ID: 998251966

View in Genome Browser
Species Human (GRCh38)
Location 5:140559470-140559492
Sequence TGAGTTTATCTGGAGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998251966_998251969 -5 Left 998251966 5:140559470-140559492 CCTAGTGCCTCCAGATAAACTCA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 998251969 5:140559488-140559510 ACTCATCACCCTGACCTATGAGG No data
998251966_998251973 9 Left 998251966 5:140559470-140559492 CCTAGTGCCTCCAGATAAACTCA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998251966 Original CRISPR TGAGTTTATCTGGAGGCACT AGG (reversed) Intronic