ID: 998251967

View in Genome Browser
Species Human (GRCh38)
Location 5:140559477-140559499
Sequence AGGGTGATGAGTTTATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998251967_998251973 2 Left 998251967 5:140559477-140559499 CCTCCAGATAAACTCATCACCCT 0: 1
1: 0
2: 0
3: 7
4: 167
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998251967 Original CRISPR AGGGTGATGAGTTTATCTGG AGG (reversed) Intronic