ID: 998251968 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:140559480-140559502 |
| Sequence | GTCAGGGTGATGAGTTTATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 110 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998251968_998251973 | -1 | Left | 998251968 | 5:140559480-140559502 | CCAGATAAACTCATCACCCTGAC | 0: 1 1: 0 2: 0 3: 7 4: 102 |
||
| Right | 998251973 | 5:140559502-140559524 | CCTATGAGGTCCCCCAAACCTGG | 0: 1 1: 0 2: 1 3: 6 4: 95 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998251968 | Original CRISPR | GTCAGGGTGATGAGTTTATC TGG (reversed) | Intronic | ||