ID: 998251973

View in Genome Browser
Species Human (GRCh38)
Location 5:140559502-140559524
Sequence CCTATGAGGTCCCCCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998251967_998251973 2 Left 998251967 5:140559477-140559499 CCTCCAGATAAACTCATCACCCT 0: 1
1: 0
2: 0
3: 7
4: 167
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251966_998251973 9 Left 998251966 5:140559470-140559492 CCTAGTGCCTCCAGATAAACTCA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251968_998251973 -1 Left 998251968 5:140559480-140559502 CCAGATAAACTCATCACCCTGAC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251965_998251973 18 Left 998251965 5:140559461-140559483 CCAGTGCTTCCTAGTGCCTCCAG 0: 1
1: 0
2: 3
3: 20
4: 244
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998251973 Original CRISPR CCTATGAGGTCCCCCAAACC TGG Intronic