ID: 998251973

View in Genome Browser
Species Human (GRCh38)
Location 5:140559502-140559524
Sequence CCTATGAGGTCCCCCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998251966_998251973 9 Left 998251966 5:140559470-140559492 CCTAGTGCCTCCAGATAAACTCA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251968_998251973 -1 Left 998251968 5:140559480-140559502 CCAGATAAACTCATCACCCTGAC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251967_998251973 2 Left 998251967 5:140559477-140559499 CCTCCAGATAAACTCATCACCCT 0: 1
1: 0
2: 0
3: 7
4: 167
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
998251965_998251973 18 Left 998251965 5:140559461-140559483 CCAGTGCTTCCTAGTGCCTCCAG 0: 1
1: 0
2: 3
3: 20
4: 244
Right 998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998251973 Original CRISPR CCTATGAGGTCCCCCAAACC TGG Intronic
901879145 1:12184168-12184190 CCCAGGAGGTCCCCAAAACATGG - Intronic
901933123 1:12609647-12609669 CCTAGCAGGTCCCCCACCCCTGG + Intronic
902323748 1:15684838-15684860 CCTCGGAGCTTCCCCAAACCTGG + Intronic
902368993 1:15993807-15993829 CCCATGGGGACCCCGAAACCAGG + Intergenic
905297561 1:36963792-36963814 CCTCTGAGGTCACACCAACCTGG - Intronic
907441049 1:54478527-54478549 CCTAGGACTTCCCCAAAACCCGG + Intergenic
910253617 1:85223728-85223750 CTTATAAGATCCCCAAAACCAGG - Intergenic
910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG + Exonic
915346730 1:155201326-155201348 CCTATGAAGACCCCCAACCCAGG + Intronic
922361680 1:224828496-224828518 CTTCTGAGGTAACCCAAACCAGG - Intergenic
923737172 1:236621164-236621186 ACAAAGAAGTCCCCCAAACCTGG - Intergenic
1063543470 10:6957574-6957596 CTCATGAGATCCCCCAACCCTGG - Intergenic
1067264009 10:44721235-44721257 CCTTTGAGGTTCGCTAAACCTGG - Intergenic
1071711980 10:88058948-88058970 CCTTTGTAGTTCCCCAAACCAGG + Intergenic
1072036538 10:91567941-91567963 ACCATCAGATCCCCCAAACCTGG + Intergenic
1073765888 10:106682657-106682679 CCTATGATGTGCCCCCAGCCTGG - Intronic
1076315794 10:129540445-129540467 CCTGCAAGCTCCCCCAAACCAGG - Intronic
1077670997 11:4157450-4157472 CCTGTGAGGTCCTACAAGCCGGG - Intergenic
1078170737 11:8927242-8927264 CCTACGATGCCCCCCAAATCAGG + Intronic
1084938568 11:72600442-72600464 GCTATGGGGTCCCGCAAAGCCGG - Intronic
1085758190 11:79218965-79218987 CCTATGAGCTTCCCAAAAGCAGG - Intronic
1089119522 11:116123997-116124019 CCTATGGGATCCCCCAGACTGGG + Intergenic
1089138926 11:116271059-116271081 CCTATGAGGTGCCCCACACGTGG - Intergenic
1093957339 12:25236074-25236096 CCTTTGAGATCCCCAAACCCTGG - Intronic
1106032605 13:26016640-26016662 TCCATGAGTTCCCCCCAACCAGG + Intronic
1106277558 13:28227297-28227319 CCTATGAGGACCCATTAACCAGG - Intronic
1109426299 13:62168886-62168908 CCTTTGGGGACCCCCAGACCTGG + Intergenic
1112448483 13:99488759-99488781 GCTCTGAGGTAACCCAAACCCGG + Intergenic
1112581892 13:100683447-100683469 CCTGGGATGTCCCCCACACCTGG + Intergenic
1113308713 13:109108567-109108589 CATATGAGTTCCCCCAAATTAGG + Intronic
1115658554 14:35467401-35467423 TATATGAGGTCCCACAAAGCTGG - Intergenic
1118315071 14:64721248-64721270 CCCATGTTGTCTCCCAAACCTGG - Intronic
1124243864 15:28053651-28053673 CCCATGAGGTCTCCCAAAGAGGG + Intronic
1127471664 15:59295759-59295781 CCTTTGGGGTCCTCCAAAGCAGG - Intronic
1128331634 15:66760050-66760072 CCCATGCCGTTCCCCAAACCTGG + Intronic
1129464893 15:75718720-75718742 CCTGTCAGTTCCCCAAAACCAGG - Intergenic
1132467148 16:82578-82600 CCCGTGAAGTCCCCTAAACCTGG - Intronic
1133519643 16:6544470-6544492 CCTATGAGATCCTACAAAACAGG - Intronic
1134080136 16:11319330-11319352 ACTTTGAGGTTCCCCATACCTGG + Intronic
1141940688 16:87274110-87274132 CCTATGTGGTGCCCCAAAGTGGG + Intronic
1147033498 17:37661361-37661383 CTTATGAAGTCCCCCAAAATGGG - Intergenic
1157129273 18:44988936-44988958 CCTAAGGGTTCCACCAAACCAGG - Intronic
1159334413 18:67044343-67044365 CCTAGGAGTTCCCCAAACCCAGG + Intergenic
1160966126 19:1747723-1747745 CCTGTGAGGGCCCCGAAACTGGG + Intergenic
1164533836 19:29069387-29069409 CCTCTGAGGGACCCCAAGCCAGG + Intergenic
1168672565 19:58251960-58251982 GCTTTGAGGTAACCCAAACCAGG + Intronic
927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG + Intronic
928331580 2:30361662-30361684 GCTTTGAGCTCCCCCAAAGCAGG - Intergenic
931700270 2:64903520-64903542 CCTCAGAGATCCCCCAAACTGGG - Intergenic
936040638 2:109146699-109146721 TCTATGGGGCCCCCCAATCCAGG - Intronic
936286941 2:111188155-111188177 CCTAGCAGGTCCCCCAGCCCGGG + Intergenic
940074776 2:149729174-149729196 ACTATGAGGTCCCAAAAACTGGG - Intergenic
943191120 2:184680841-184680863 CCTAGGAGCTCCCCCAAGCCAGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948988262 2:241539337-241539359 CGTGTGACGTCCCCCATACCTGG + Intergenic
1170572946 20:17642638-17642660 CCTGTGAGGTTCCCCAGCCCAGG - Intronic
1172907027 20:38378003-38378025 CCCATGAGGACCCCAAAGCCTGG - Intergenic
1174402350 20:50282834-50282856 TCCAGGTGGTCCCCCAAACCTGG + Intergenic
1176252349 20:64131773-64131795 CCCACCAGGTCCCCTAAACCTGG - Intergenic
1180186998 21:46145104-46145126 TCTGTGGGGTCCCCCAAGCCTGG + Intronic
1180256841 21:46635572-46635594 CCTAAGACGTCCCCCATTCCAGG - Intronic
1180809796 22:18751755-18751777 AATATGAAGTCCCCCAAAACTGG - Intergenic
1181278739 22:21703564-21703586 CCTAAGAGTTCCCCCAAAACAGG + Intronic
1182511028 22:30820546-30820568 CCTCTGAGGTCAGCCAGACCAGG + Intronic
1182663627 22:31942591-31942613 CCGAGGAGGTCCCCCCATCCAGG + Intronic
951526547 3:23658100-23658122 CCTGTGAGGTTCCCCAGCCCAGG + Intergenic
953749104 3:45595865-45595887 CCAATGTGGACCCCCAACCCTGG + Exonic
954537274 3:51370499-51370521 CCTGTGAGGTCCCCAAGAGCAGG - Intronic
960403258 3:117229409-117229431 CCTATGAGGTGCCCCAAAGCTGG + Intergenic
969222846 4:5772703-5772725 CCCATGAGGTCCACACAACCTGG + Intronic
969619319 4:8270992-8271014 CCTAAGAGGCACCCCAAACAGGG - Intronic
975443095 4:74435223-74435245 ACTCTGAGGTAACCCAAACCAGG + Intergenic
986489041 5:8270671-8270693 CATATGGGGTCCCCTACACCTGG + Intergenic
987856207 5:23423448-23423470 CATCTGGTGTCCCCCAAACCCGG - Intergenic
995598598 5:113773155-113773177 ACTCTGAGGTAACCCAAACCGGG + Intergenic
998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG + Intronic
999398555 5:151247014-151247036 GCTCTGAGGTAACCCAAACCAGG + Intronic
999643434 5:153695081-153695103 CCTTTGAGGTCCACAAGACCTGG + Intronic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1008689157 6:53958336-53958358 CTTATGAGGTACCTTAAACCAGG - Intronic
1017524735 6:155232586-155232608 CCTCAGAGTTTCCCCAAACCAGG - Intronic
1019658381 7:2210009-2210031 CCTAAGAACTACCCCAAACCTGG + Intronic
1022309793 7:29186205-29186227 CCTATGAGTTCCCCAGAGCCTGG + Intronic
1023120705 7:36905409-36905431 CCTAGGAGCTCCCCAAAATCAGG + Intronic
1030549911 7:110945450-110945472 CCTTTGAGGTCTCCCAAAAAGGG - Intronic
1032322848 7:130900282-130900304 CCTGTGAGGTTCCCCAGCCCAGG - Intergenic
1035289033 7:157825366-157825388 CCTCTGAGGTCCCAGAAACAAGG - Intronic
1037595492 8:20350886-20350908 TCTATGAGCTCCCCCAGGCCAGG + Intergenic
1039796298 8:40918407-40918429 CCTGTGGGGTCCCCCAAGCATGG - Intergenic
1040920935 8:52616078-52616100 GCTATTAGGTCCCACAAAACTGG + Intergenic
1043857794 8:85281359-85281381 CCAATGAACTCCCCCAAACATGG + Exonic
1044928226 8:97227242-97227264 CCTCTGAGGTCCTCTACACCTGG - Intergenic
1046743458 8:117852435-117852457 TCTATCAAGTCCCCAAAACCTGG - Intronic
1047731834 8:127735045-127735067 CCTTTGATTTCTCCCAAACCCGG + Intergenic
1057726084 9:97569150-97569172 CCTTGGAGGTCCCTCAAAGCTGG - Intronic
1058910646 9:109517325-109517347 CCTTTGAGGTCCCCCAGGCCTGG + Intergenic
1061290386 9:129647416-129647438 CCCTTGAGGTCCCCTCAACCTGG + Intergenic
1185650112 X:1641633-1641655 CCTGTGAGGTCCACCCATCCTGG + Intronic
1185650128 X:1641716-1641738 CCTGTGAGGTCCACCCATCCTGG + Intronic
1188756606 X:33970045-33970067 CCTATGAGCTCCCCAAACCAGGG + Intergenic
1202246425 Y:22824892-22824914 CATATGTGGACCCCCAAAACAGG + Intergenic
1202399413 Y:24458640-24458662 CATATGTGGACCCCCAAAACAGG + Intergenic
1202471367 Y:25211446-25211468 CATATGTGGACCCCCAAAACAGG - Intergenic