ID: 998252123

View in Genome Browser
Species Human (GRCh38)
Location 5:140560514-140560536
Sequence GGCCCTCTAGTGACTAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998252123 Original CRISPR GGCCCTCTAGTGACTAGGCC TGG (reversed) Intronic
904664524 1:32109507-32109529 GGCCCTCTAGTGGTTGGGCAGGG + Intronic
905044299 1:34984242-34984264 GGCTCCCTAGTGCCAAGGCCTGG + Intronic
910838526 1:91539411-91539433 GGCCCTGGAGTGATTAGGGCAGG + Intergenic
911169194 1:94753561-94753583 TGCTTTCTAGTGACTAGGACAGG - Intergenic
920387582 1:205579751-205579773 GGGCCCATAGTGACTGGGCCAGG - Exonic
921932425 1:220765550-220765572 GACTCTCTAGTGACTGGGCCTGG - Intronic
1073080152 10:100854500-100854522 GGCTCTCAGGTGTCTAGGCCTGG - Intergenic
1075476979 10:122744542-122744564 TGCCCTGTAGTGGCTAGGCCAGG + Intergenic
1076378784 10:130011130-130011152 GGCCCTCCAGCCCCTAGGCCTGG + Intergenic
1078655141 11:13231724-13231746 GGCACTCTAATGTCTAGGTCAGG + Intergenic
1079238160 11:18704170-18704192 AGCCTTCTTGTGACTGGGCCTGG - Exonic
1084774430 11:71366117-71366139 GGCCATCCAGTGACAAAGCCTGG - Intergenic
1085329563 11:75636668-75636690 GGCCCTGGAGTGATTAGGGCAGG - Intronic
1086463430 11:87029095-87029117 GCCCCTTTAGTGCCTAGCCCAGG - Intergenic
1097702516 12:62834695-62834717 GCCCCCCCAGTGACTTGGCCTGG - Intronic
1099405473 12:82255777-82255799 GTCCCTCTAGTGACTAAGTAAGG + Intronic
1100726408 12:97413660-97413682 GGCCCTTTAGTGACAAGTCTCGG + Intergenic
1102819472 12:115895632-115895654 GGCCCTGTAGTGATTAGGGTAGG + Intergenic
1103711710 12:122917731-122917753 GGCCCTGTGTTGACAAGGCCTGG - Intergenic
1124480481 15:30075004-30075026 GGCCCTGGGGTGACTAGGGCAGG - Intergenic
1124785516 15:32675842-32675864 GACCCTCTAGTACCTAGCCCAGG + Intronic
1126630262 15:50727668-50727690 GGCCTTCTAGTGAGTTGGCAAGG - Intronic
1131994614 15:98122139-98122161 GGCACTCTAGAGACAAGCCCAGG + Intergenic
1135550177 16:23391792-23391814 GGCCCTCCAGTGAAGAGGGCAGG + Intronic
1141669507 16:85484508-85484530 GGCCCTTGAGTGACGAAGCCAGG + Intergenic
1142191621 16:88720776-88720798 GGCCCCCTGGGGACTGGGCCTGG + Intronic
1146929842 17:36769163-36769185 TGCCCTCCAGTGTCTGGGCCAGG + Intergenic
1158543056 18:58374335-58374357 GGCCCTTCAGTGGCTAGGCAAGG + Intronic
1161447957 19:4328563-4328585 GACCCGCTAGTGGGTAGGCCAGG - Intronic
1162138023 19:8568077-8568099 GGGCCTCTAGTGCCTGGGGCAGG - Intronic
1163748399 19:19061346-19061368 GGGCCTCAGGTGATTAGGCCTGG + Intergenic
1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG + Intronic
1167602599 19:50463238-50463260 GGCCCTGTAGTCTCTGGGCCTGG - Intronic
925175666 2:1782023-1782045 GGGCCTCTAGTTTCTAGGACCGG - Intergenic
927654256 2:24932129-24932151 GGCTCGATAATGACTAGGCCAGG + Intergenic
927948075 2:27149314-27149336 GGCCCTCGAGGGACCAGGGCTGG + Exonic
929613803 2:43292406-43292428 GGGCCTCTAGTGACTTGGGATGG + Intronic
934656415 2:96118728-96118750 GGCCAGCTAGGCACTAGGCCAGG + Intergenic
938781221 2:134586742-134586764 TGCCGTCTCGTGACTGGGCCAGG - Intronic
947542795 2:230990395-230990417 GGCCCTCGACAGACTGGGCCGGG - Intergenic
947637497 2:231687537-231687559 GGACCTCCTGTGACTATGCCTGG + Intergenic
947741342 2:232486392-232486414 GGCCCTCAAGTACCTGGGCCCGG - Exonic
1181182004 22:21074942-21074964 GACCCTCCAGGGACCAGGCCTGG - Intergenic
1183135727 22:35885494-35885516 GGCAGGCTAATGACTAGGCCAGG + Intronic
1183344447 22:37299298-37299320 GGCCCTCAGGTGAGTAGTCCTGG + Exonic
1183469119 22:37996395-37996417 GTCCCCCTAGTGCCAAGGCCTGG - Intronic
949120627 3:379499-379521 ACCCCTCTACTCACTAGGCCTGG - Intronic
950408671 3:12820318-12820340 GGCCCTCCAGTTAAAAGGCCTGG + Intronic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
954696362 3:52429332-52429354 GTCTCCCTAGTGACTAAGCCAGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
961046703 3:123713393-123713415 GGCCTTCTGATGACAAGGCCGGG + Intronic
961872165 3:129996469-129996491 GGCCCTGGAGTGATTAGGGCAGG + Intergenic
969536916 4:7761948-7761970 GGGCCTCCACGGACTAGGCCGGG + Exonic
969608852 4:8216079-8216101 AGCCCTCGGGTGACTGGGCCTGG + Intronic
970261189 4:14226854-14226876 GGCCCTGGAGTGATTAGGTCAGG - Intergenic
973562488 4:52150821-52150843 GGACCTCTAGTCAGGAGGCCTGG + Intergenic
976270172 4:83222475-83222497 GGCCCTGGGGTGATTAGGCCAGG - Intergenic
978365698 4:107979137-107979159 GGCACACTAGTGACTATGCCAGG + Intergenic
981579028 4:146233739-146233761 GGCCTTCAAGTGACTGGGCCAGG - Intergenic
984651590 4:182276119-182276141 GGCTCTCTGGTGCCTAAGCCTGG - Intronic
990649795 5:57885417-57885439 GGCCCTGTAGTAGCTAGACCAGG + Intergenic
992170315 5:74094965-74094987 GGCCCAATAGTCACTGGGCCAGG + Intergenic
996001447 5:118369069-118369091 TGCCCTGTGGTGACTAGGTCAGG - Intergenic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
999076111 5:148797206-148797228 GGGCCTCCAGTGTCCAGGCCTGG - Intergenic
1001387640 5:171353187-171353209 GGCCCTCTGGGGCCTGGGCCAGG - Intergenic
1003251054 6:4429553-4429575 GGCCCTGGAGTGACTGGGACTGG - Intergenic
1003412731 6:5879817-5879839 TCCCCTCTAATCACTAGGCCAGG + Intergenic
1004591373 6:17054963-17054985 GGCCCTGGAGTGATTAGGGCAGG + Intergenic
1008131659 6:47726028-47726050 GTCCTTCTAGTGATTAGGACTGG + Intergenic
1013974262 6:116059127-116059149 GGCCCACTACTGTCTATGCCTGG + Intronic
1021435023 7:20604207-20604229 GGCCCTGCAGTGATTAGGGCAGG - Intergenic
1026015596 7:66668663-66668685 GGCTCTGCAGTGACAAGGCCTGG - Intronic
1026825496 7:73578812-73578834 GGCGCTCTAATAACTAGGCTCGG - Intergenic
1026892005 7:73987826-73987848 GGCTCTGCAGTGACAAGGCCTGG - Intergenic
1027185468 7:75968326-75968348 GGGCCACCAGTGCCTAGGCCTGG - Intronic
1032278161 7:130477980-130478002 GGGACTCTAATGACCAGGCCTGG - Intergenic
1034101867 7:148457504-148457526 GGCCCTGTAGTGACCCAGCCAGG - Intergenic
1035402449 7:158576436-158576458 GGCCCTCTCGGGACAAGCCCCGG + Intronic
1038790954 8:30667895-30667917 GGCCCTGGAGTGATTAGGGCAGG - Intergenic
1048468057 8:134683832-134683854 GGGCCTCCATTGACTAGACCTGG - Intronic
1050681432 9:8116347-8116369 TGCCTTCTAGAGACTGGGCCTGG - Intergenic
1053067368 9:35078155-35078177 GGGTCTCTAGTAACAAGGCCAGG + Exonic
1061025138 9:128043572-128043594 AGCCCTCTAATGGCCAGGCCAGG + Intergenic
1185953174 X:4458797-4458819 GGCCCTATAGTGATCAGGCCAGG - Intergenic
1187206626 X:17187670-17187692 GGTCCTTTAGTGACAAAGCCAGG + Intergenic
1192145644 X:68680466-68680488 TGCCCTCTTGTGACTAGCCAGGG - Intronic
1195655671 X:107329328-107329350 GGCCTACTACTGACCAGGCCTGG - Intergenic