ID: 998252657

View in Genome Browser
Species Human (GRCh38)
Location 5:140563289-140563311
Sequence TGTGGACCAGAACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998252652_998252657 28 Left 998252652 5:140563238-140563260 CCATCTCAAAAAATAAAAAATAA 0: 436
1: 1215
2: 96365
3: 82526
4: 91539
Right 998252657 5:140563289-140563311 TGTGGACCAGAACCCCAAAGTGG 0: 1
1: 1
2: 0
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998252657 Original CRISPR TGTGGACCAGAACCCCAAAG TGG Intronic
902229021 1:15015683-15015705 TGTGGAGCAGACCCAGAAAGGGG - Intronic
903323471 1:22556159-22556181 TGCGGAGCAGCACCCCAGAGAGG + Intergenic
906993568 1:50765677-50765699 TGAGGTCCAGAAGCCCATAGAGG - Intronic
913562473 1:120035632-120035654 TGAGGACCAGAACCCTCCAGGGG - Intronic
913635649 1:120757975-120757997 TGAGGACCAGAACCCTCCAGGGG + Intergenic
914283063 1:146195013-146195035 TGAGGACCAGAACCCTCCAGGGG - Intronic
914544093 1:148645731-148645753 TGAGGACCAGAACCCTCCAGGGG - Intronic
914622532 1:149425279-149425301 TGAGGACCAGAACCCTCCAGGGG + Intergenic
915363579 1:155300913-155300935 TGTGGAGCAGACCCACAGAGAGG - Intronic
917629335 1:176877443-176877465 TGTGGACCAGGAATCCAGAGTGG + Intronic
921215371 1:212932451-212932473 TGTGGACCAGCATCCCACACAGG - Intergenic
923079139 1:230637192-230637214 TGGAAACCAGACCCCCAAAGAGG + Intergenic
1065130107 10:22612220-22612242 TCTGGACCATAAGCCCCAAGAGG - Intronic
1065267898 10:23996334-23996356 TGGGGACCATAACCGCAAAATGG + Intronic
1066231264 10:33436020-33436042 GGCGGAGCAGAGCCCCAAAGGGG + Intergenic
1070527121 10:77304865-77304887 TGCGGTCCAAGACCCCAAAGAGG + Intronic
1071272094 10:84017324-84017346 TGTGGACCAAAGCCACAAAGAGG - Intergenic
1071885276 10:89943054-89943076 TGTGTCACAGAAACCCAAAGTGG - Intergenic
1072719173 10:97770479-97770501 TGTGGACCAGCACAGAAAAGGGG + Intronic
1072855724 10:98944055-98944077 TGAGGACCAAAATCCCAGAGAGG + Intronic
1073730039 10:106277022-106277044 TGTGGAAAAGATCCCCACAGTGG - Intergenic
1076867259 10:133174112-133174134 TGTAGACCAGAACCAGCAAGAGG - Intronic
1077058331 11:606625-606647 TGAGGACCAGCAGCCCACAGAGG - Intronic
1078097578 11:8310152-8310174 TGAGGACCTGAAGCCCAGAGAGG + Intergenic
1078457360 11:11485688-11485710 TGTGGACCAGACAGCAAAAGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079464658 11:20717943-20717965 TGTGGACCAAAACCCCAAAGAGG + Intronic
1081412814 11:42779979-42780001 TGTGGAACAGAACCACATAAAGG - Intergenic
1083160352 11:60850497-60850519 TGTGGGACAGAAGCCCAGAGGGG + Exonic
1084774550 11:71366839-71366861 TGTTGACCAGACCCACAAAGTGG + Intergenic
1085024498 11:73228695-73228717 GGTGGACCAGAACCCCTAGAGGG + Intronic
1202828215 11_KI270721v1_random:100114-100136 TGAGGAGCAGAACCCCGATGAGG + Intergenic
1091425446 12:384236-384258 TGTGGACCAGTACCCATCAGCGG + Intronic
1091978310 12:4844564-4844586 TGAGGAACAGAACAGCAAAGGGG + Intronic
1092956548 12:13556067-13556089 TATGGACCAGAACAACAGAGGGG + Exonic
1093096796 12:14981165-14981187 TGTGGATCACCTCCCCAAAGAGG + Intronic
1095278456 12:40319814-40319836 TGTGGCCTAGAAGCCCAGAGGGG - Intronic
1104061773 12:125274618-125274640 TTTGGGGAAGAACCCCAAAGAGG + Intronic
1104374830 12:128255686-128255708 AGTGAACGATAACCCCAAAGAGG + Intergenic
1108122731 13:47207587-47207609 TGTGGACCCCACCCCCAGAGTGG + Intergenic
1108768828 13:53670332-53670354 TGTTGTACAGTACCCCAAAGTGG - Intergenic
1109186938 13:59280916-59280938 AGTGGACTGAAACCCCAAAGGGG + Intergenic
1109978290 13:69871248-69871270 TGGGGAGCAGTACTCCAAAGTGG + Intronic
1111977440 13:94981344-94981366 TGTGAACCAGAATCACACAGAGG - Intergenic
1112643407 13:101303023-101303045 TGTAGACCAGAACTCTACAGAGG + Intronic
1115449702 14:33532397-33532419 TGCTGAAGAGAACCCCAAAGAGG - Intronic
1117433541 14:55695098-55695120 TGTGGAGCAGAATACCCAAGAGG + Intronic
1125679217 15:41520486-41520508 GGAGGACCAGGGCCCCAAAGAGG + Exonic
1127602951 15:60556619-60556641 TGTGGACCATAACCCAAAGGTGG + Intronic
1131063544 15:89418777-89418799 TGGGTTTCAGAACCCCAAAGAGG - Intergenic
1131420525 15:92301107-92301129 GGTGGTACAGAACCCTAAAGAGG + Intergenic
1132382535 15:101376592-101376614 TGTGGAACAGTACCACAAATAGG + Intronic
1139423227 16:66862114-66862136 AGTGGACCAGAGCTGCAAAGTGG - Intronic
1141459307 16:84168063-84168085 TGTGGGTCAGAAGCCCAAAATGG + Intronic
1141867335 16:86759803-86759825 TGTGTAGCAGAGCCCCAAGGAGG - Intergenic
1142095202 16:88235569-88235591 CGGGAACCAGAACCCAAAAGAGG + Intergenic
1143010516 17:3863866-3863888 TGTGGTCCAGCACCCCCTAGTGG - Intronic
1146451220 17:32975533-32975555 TGAGGACCAAGACCCCCAAGGGG - Intronic
1151435448 17:74093037-74093059 TGGGGAACAGAAGCCCAACGTGG + Intergenic
1151492352 17:74440139-74440161 TGGCGAACAGAACCCCAAAGAGG - Exonic
1155066891 18:22275916-22275938 TGTGGACCAAAACACCAAAAGGG - Intergenic
1156398719 18:36721787-36721809 TCTGAGCCAGAAACCCAAAGTGG - Intronic
1156631626 18:38976074-38976096 TCTGGACCATAACCCCAAGAAGG + Intergenic
1158385810 18:56990338-56990360 TGTGGACCAAAAGCCCATATGGG + Intronic
1161187452 19:2930985-2931007 TGTGTACCTGAATCCTAAAGAGG + Intergenic
1161715966 19:5876574-5876596 TGAAGACCAGGACCCCAACGAGG - Intronic
1163710680 19:18845013-18845035 TGGGGAGCAGCACCCCACAGAGG - Intronic
1164183217 19:22837905-22837927 GGTGGCCCAGAACCCCAAGTTGG - Intergenic
1165008627 19:32826673-32826695 TCTTGAACAGAACCCCAACGTGG + Intronic
1165795319 19:38516027-38516049 TGGGACCCAGGACCCCAAAGAGG + Intronic
925879508 2:8340414-8340436 TGTGGACCAGGACTGCACAGTGG - Intergenic
935530039 2:104221010-104221032 TGTGGAGAAAAACCCCAAGGAGG - Intergenic
939550378 2:143607870-143607892 TCTGCACCAGAACTCCTAAGTGG + Intronic
942050537 2:172136456-172136478 TGTGGCCCAGGAACCCACAGGGG - Intergenic
947962393 2:234250262-234250284 AGTTGACCAGAACCCACAAGGGG + Intergenic
1173610440 20:44363514-44363536 TATGAACCAGCACCCCCAAGAGG - Intronic
1175890991 20:62315829-62315851 TGTGGAAGAGACCCCCACAGTGG - Intronic
1179011843 21:37562581-37562603 TTTGGAACAGAACCCCACAAGGG + Intergenic
1179419280 21:41222792-41222814 TGTGGGCCAGAACCTGAAGGTGG + Intronic
1183001266 22:34861399-34861421 TGTGGCCCTGAAACCCCAAGAGG + Intergenic
1183653328 22:39171464-39171486 TGTGGAGCAGAACCAAAATGAGG + Intergenic
1184579152 22:45401703-45401725 TGTGGACCAGAAGACCCAATTGG + Intronic
952020981 3:29019741-29019763 AGTGGCCTATAACCCCAAAGTGG - Intergenic
955440375 3:58948434-58948456 CATGGACCAAAACCACAAAGGGG - Intronic
955653944 3:61223977-61223999 TTTGGACCAGTAACCCATAGAGG - Intronic
956360559 3:68442282-68442304 CTTGGACCAGAATCCCAACGTGG + Intronic
959671676 3:108985138-108985160 TTTGAACCTGAACCCCAAATAGG - Intronic
960967722 3:123116696-123116718 GGTGGACCAGAAGCATAAAGGGG + Intronic
961356810 3:126344611-126344633 ACTGGACCAGAACTCCACAGGGG + Intronic
962351970 3:134663055-134663077 GGTAGAGCAGAACCCCAGAGAGG + Intronic
962457388 3:135577149-135577171 TGTTCAACAGAACCCAAAAGAGG + Intergenic
967884731 3:194325718-194325740 TGGGGAACTGAACTCCAAAGAGG + Intergenic
968870163 4:3238087-3238109 TAGGGACCAGAACTCCTAAGAGG - Intronic
968870175 4:3238149-3238171 TAGGGACCAGAACTCCTAAGAGG - Intronic
972644075 4:40951618-40951640 TGTGCATCTGAAGCCCAAAGAGG - Intronic
975970565 4:80029824-80029846 TGTGGTCAAGAACAGCAAAGAGG + Intronic
979399112 4:120225978-120226000 TGAGGAAAAGAACCACAAAGAGG + Intergenic
980546957 4:134276800-134276822 TGTGGAAGAGAACCCCAATAGGG - Intergenic
984474063 4:180215209-180215231 AGGGGCCCAGAACCCCACAGGGG - Intergenic
984870468 4:184320252-184320274 TGAGGACCAGAACTCCCAAATGG - Intergenic
989137082 5:38166616-38166638 TGGGGACCAGCACCAGAAAGAGG - Intergenic
990560351 5:56977802-56977824 TGAGGCCCAGAACTTCAAAGGGG + Intergenic
991113208 5:62925141-62925163 AGTGATCCAGAACACCAAAGTGG + Intergenic
992572813 5:78077244-78077266 TGTGGATCACAAACCCTAAGTGG - Intronic
995725448 5:115177488-115177510 AGTGGAACCGAACCCCACAGAGG + Intronic
998252657 5:140563289-140563311 TGTGGACCAGAACCCCAAAGTGG + Intronic
998757669 5:145398559-145398581 TGTGGATCACAACTCCAAAATGG - Intergenic
1000894491 5:166839057-166839079 TATGGTCCAAGACCCCAAAGTGG - Intergenic
1002193619 5:177491159-177491181 TGTGGCTCAGAACCCCACACTGG + Intronic
1002459869 5:179367979-179368001 TGTGGACTAGAAGTCTAAAGGGG + Intergenic
1003224254 6:4190187-4190209 TGTGGTTTGGAACCCCAAAGAGG + Intergenic
1005372863 6:25153392-25153414 TGTGGACCTCAAGTCCAAAGAGG + Intergenic
1005752951 6:28900445-28900467 TGTGCATCAGAACCCTAAAATGG + Intergenic
1007708422 6:43805869-43805891 TGTGAACCAGGACCACAAACAGG - Intergenic
1010021560 6:71165515-71165537 TGTGGAAAGGAAGCCCAAAGTGG - Intergenic
1018706101 6:166464166-166464188 TGTGGGCAAGAAGACCAAAGTGG + Intronic
1019367239 7:640460-640482 TGTGAATCAAAACCACAAAGAGG + Intronic
1019399600 7:844701-844723 TGTGGACCAGCACCGCTGAGCGG + Intronic
1019831349 7:3334119-3334141 TCTAGAGCAGAACCCCAATGTGG + Intronic
1020209607 7:6148830-6148852 TCTGGAGCAGAGCCCAAAAGGGG - Intronic
1025301130 7:57820453-57820475 TGAGGACAAGAGCCCCACAGGGG + Intergenic
1029515516 7:101020834-101020856 TGTGGCCATGAAGCCCAAAGCGG - Intronic
1031218710 7:118933502-118933524 TGTAGAGCAGAATACCAAAGAGG - Intergenic
1033278833 7:139991729-139991751 TGTGGGACAAAACCCCAAAAGGG - Intronic
1036503146 8:9331785-9331807 TAGGAACCAAAACCCCAAAGGGG - Intergenic
1037853607 8:22353306-22353328 TGTGGACTAGAATCTCAGAGAGG + Intronic
1039002649 8:32998481-32998503 TGTGTTCCAGAATCCCAAACAGG + Intergenic
1039476332 8:37841197-37841219 TCTGGCACAGAACCCCAAGGCGG + Exonic
1044277631 8:90321102-90321124 ACTGGACCAGAAGCCCAAGGGGG - Intergenic
1052441763 9:28506189-28506211 TGTGGAACAGAAGTTCAAAGTGG - Intronic
1062077123 9:134595464-134595486 GATGGAACAGAACCCCAGAGAGG - Intergenic
1186238816 X:7544411-7544433 TGAGGAACAGAAGCCCAGAGAGG + Intergenic
1196815641 X:119663486-119663508 TGGGGACCAGATCAACAAAGAGG - Exonic
1198182573 X:134223935-134223957 TTTGGACCTGAGTCCCAAAGGGG + Intergenic