ID: 998253495

View in Genome Browser
Species Human (GRCh38)
Location 5:140568020-140568042
Sequence GGCGTTGACCACCAGCGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998253495_998253499 29 Left 998253495 5:140568020-140568042 CCTGCTCGCTGGTGGTCAACGCC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 998253499 5:140568072-140568094 GCTCACAGCCGCCTTCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 278
998253495_998253497 1 Left 998253495 5:140568020-140568042 CCTGCTCGCTGGTGGTCAACGCC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 998253497 5:140568044-140568066 TGCTCTCAGCAGTCCTGCTACGG 0: 1
1: 1
2: 0
3: 6
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998253495 Original CRISPR GGCGTTGACCACCAGCGAGC AGG (reversed) Exonic
900624578 1:3602393-3602415 GGCACTGACCACCCGGGAGCTGG - Intronic
906953959 1:50357374-50357396 GGCGTTGAGCAAGAGCGAGCTGG - Intergenic
912591784 1:110829637-110829659 GTTGTTGAACACCAGCCAGCTGG - Intergenic
916107392 1:161441630-161441652 GGCGTTGCCCTCCGGCGGGCGGG - Intergenic
916108977 1:161449048-161449070 GGCGTTGCCCTCCGGCGGGCGGG - Intergenic
916110565 1:161456429-161456451 GGCGTTGCCCTCCGGCGGGCGGG - Intergenic
916112150 1:161463839-161463861 GGCGTTGCCCTCCGGCGGGCGGG - Intergenic
916113737 1:161471220-161471242 GGCGTTGCCCTCCGGCGGGCGGG - Intergenic
1069900664 10:71705015-71705037 GGTGGTCACCACCACCGAGCTGG + Intronic
1104854721 12:131896261-131896283 GGCCCTGACTGCCAGCGAGCAGG - Intronic
1122275133 14:100587230-100587252 GGCGGTGAGTACCTGCGAGCCGG - Intronic
1122780858 14:104142864-104142886 GGGGGTGACCACCAGCAAGTGGG - Intronic
1129195688 15:73964909-73964931 GGCATTTACCACCAGGGGGCGGG - Intergenic
1132055619 15:98648806-98648828 GGCTGTGACCTTCAGCGAGCCGG + Intergenic
1132947182 16:2538115-2538137 GGCCAGGACCACCAGCCAGCTGG + Exonic
1136005139 16:27324248-27324270 GGCCCTGACCTCCAGAGAGCTGG - Intronic
1137644302 16:50060725-50060747 GGCCTGGACTACCATCGAGCTGG - Intergenic
1150235814 17:63591969-63591991 GGCCTCTACCACCAGAGAGCTGG + Exonic
1152590272 17:81208335-81208357 GGCATTGTCCCCGAGCGAGCAGG - Intronic
1152656533 17:81522409-81522431 GGCGTTGTCCCCAAGGGAGCTGG + Intronic
1153991981 18:10408435-10408457 GAGGCTGCCCACCAGCGAGCGGG + Intergenic
1158471531 18:57741403-57741425 AGCATTGACCAACAGCCAGCAGG + Intronic
1160322148 18:77905864-77905886 GGCGCTGGGCAGCAGCGAGCAGG - Intergenic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
928174429 2:29024338-29024360 GGTGAGGACCACCAGGGAGCGGG - Exonic
932257548 2:70300851-70300873 GGCTTTGGTCACCAGTGAGCTGG - Exonic
932779128 2:74549127-74549149 GGCGTCGGCCACGAGAGAGCGGG + Intronic
942429211 2:175891909-175891931 GGTCTTCACCACCAGCGAGTGGG - Intergenic
948921245 2:241066892-241066914 GGAGTTGACCACCAAGGGGCTGG + Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169287805 20:4324256-4324278 GGAGTTGGCCAACAGGGAGCAGG - Intergenic
1171250549 20:23642879-23642901 GGTGTTGACCCCCAGCGCGACGG + Intergenic
1172091789 20:32437816-32437838 GGCATTGCCCACCAGGGGGCTGG + Exonic
1176021918 20:62966475-62966497 GGCCCTGGCCACCACCGAGCTGG - Intronic
1182484162 22:30629302-30629324 TGCCTTGACCAACAGCCAGCAGG - Intergenic
1184750211 22:46481526-46481548 GGCTTTGATCACCAGTGAGCTGG - Intronic
1184835495 22:47018718-47018740 GGCGATGACGACCGGTGAGCAGG - Intronic
962075114 3:132073450-132073472 TTCCTGGACCACCAGCGAGCTGG + Intronic
975177004 4:71300362-71300384 GGCATTGACCACCAGTGAGCAGG + Intronic
979205768 4:118035490-118035512 GCTGTTCACCACCAGAGAGCAGG + Intronic
984045884 4:174797840-174797862 AGCTTTGACCACCAGGGATCAGG - Intronic
998253495 5:140568020-140568042 GGCGTTGACCACCAGCGAGCAGG - Exonic
1002121382 5:177006854-177006876 GGCGCTGACCGCCCGTGAGCCGG + Intronic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1010823227 6:80440955-80440977 GGCTTTCACCACCAGCCACCTGG - Intergenic
1016428093 6:143955650-143955672 GGCGCTCACCACCAGGGAGCTGG + Intronic
1019711446 7:2519917-2519939 GGCGGTGAGCACCAGCAGGCAGG - Exonic
1020409286 7:7873276-7873298 GGCTTTGATCACCTGTGAGCAGG - Intronic
1026592711 7:71710831-71710853 GGAGTTGTCCACCAGGCAGCGGG - Exonic
1060147412 9:121264899-121264921 GGCTTTTACCAGCAGCAAGCTGG - Intronic
1062502226 9:136856494-136856516 GGCCCTGACCAGCAGGGAGCTGG + Intronic
1062571681 9:137188717-137188739 GGCGTTGACCATGACCCAGCAGG + Exonic
1187392082 X:18892666-18892688 GGCGTTCACCCCACGCGAGCGGG + Exonic
1199711139 X:150470497-150470519 GGCGTTGGCAGCCAGCAAGCAGG + Exonic
1200093127 X:153644935-153644957 GGCTGTGACCAGCAGGGAGCTGG - Intronic
1200903740 Y:8460122-8460144 AGCGCTGACCACCAGAGAGATGG + Intergenic
1201548965 Y:15198579-15198601 GGCTTTGAGCACAAGGGAGCAGG - Intergenic