ID: 998255401

View in Genome Browser
Species Human (GRCh38)
Location 5:140583109-140583131
Sequence CCAGGTAAAGAGATTGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998255395_998255401 10 Left 998255395 5:140583076-140583098 CCAGAAGAAATAGAAATTCCGAA 0: 1
1: 1
2: 10
3: 55
4: 274
Right 998255401 5:140583109-140583131 CCAGGTAAAGAGATTGAATCGGG 0: 1
1: 0
2: 1
3: 16
4: 211
998255397_998255401 -8 Left 998255397 5:140583094-140583116 CCGAATAGACCTATACCAGGTAA 0: 1
1: 0
2: 5
3: 18
4: 147
Right 998255401 5:140583109-140583131 CCAGGTAAAGAGATTGAATCGGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998255401 Original CRISPR CCAGGTAAAGAGATTGAATC GGG Intronic
900985354 1:6069945-6069967 CCAGGAACAGATATGGAATCAGG + Intronic
904730036 1:32583401-32583423 TCAGGTTAAGTGACTGAATCTGG + Intronic
905986971 1:42294377-42294399 TTAGGTAAACAGCTTGAATCAGG - Intronic
909238636 1:73183553-73183575 GCAGGTAAAGGGAATGAGTCAGG - Intergenic
909238666 1:73183721-73183743 GCAGGTAAAGGGAATGAGTCAGG - Intergenic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
911451567 1:98068219-98068241 CAAGGTAAAGACATGGAATTTGG + Intergenic
915080805 1:153350364-153350386 GCAGGTAAAGAGATAGACTTGGG - Intergenic
916060472 1:161095040-161095062 CCAGGCAAAGAGACTGCATGAGG - Intergenic
916223649 1:162467896-162467918 ACAGTTAAAAAGATAGAATCTGG - Intergenic
916504290 1:165413938-165413960 ACAGATAAAGAGATGGAATTGGG - Intronic
921406614 1:214786943-214786965 CCAGATACAGAATTTGAATCAGG - Intergenic
921910187 1:220540034-220540056 ACTAGTAAGGAGATTGAATCAGG - Intronic
922666949 1:227478576-227478598 CTAGGCAAAAAGATTGAAGCTGG + Intergenic
1063315957 10:5006507-5006529 CCAGGAAAATAGCTTGAACCTGG + Intronic
1065761885 10:28990338-28990360 CCAGGTAAAGAGACTGTATGTGG + Intergenic
1065972242 10:30814934-30814956 CCAGGTTTAGGGATTGAATCAGG - Intergenic
1066079157 10:31912437-31912459 GCAGTGAAAGAGATTGAATGTGG - Intronic
1069349341 10:67506988-67507010 CTAGCTAAAGAGACTGAATATGG - Intronic
1069840718 10:71337746-71337768 CCAGGTAAAGAGGTTTCTTCGGG - Intronic
1069908023 10:71743492-71743514 CCAGGAAATGAGACTGACTCTGG + Intronic
1071123890 10:82312465-82312487 ACAGGTAAAAAGATTGAAAATGG - Intronic
1073093897 10:100968677-100968699 CTGGGTAAGGTGATTGAATCTGG + Intergenic
1074919831 10:117996236-117996258 CCAGCAAAAGAGATTCAATATGG - Intergenic
1075132808 10:119754815-119754837 CCAGGGCAAGAGCTTTAATCGGG - Intronic
1075366626 10:121896190-121896212 CTTGCTAAAGAAATTGAATCTGG - Intronic
1076077507 10:127547154-127547176 GAAGGTAAAGAGAAGGAATCAGG - Intergenic
1078978807 11:16507247-16507269 CAAAGAAAAGAGATTTAATCAGG - Intronic
1079987176 11:27211695-27211717 CCAGGTAAATAGGTACAATCTGG - Intergenic
1080405457 11:31974819-31974841 CCAGGTGAGGTGATTGGATCTGG + Intronic
1080679003 11:34456142-34456164 CCAGGTCATGACATTTAATCAGG + Exonic
1080917179 11:36672143-36672165 CCAGGTAATGAGAGTGAATAGGG + Intergenic
1081115782 11:39197989-39198011 TCAGGCAAAGAGAAGGAATCAGG + Intergenic
1081322099 11:41703848-41703870 TCAGGTAAAGGGATGAAATCTGG + Intergenic
1081635868 11:44721601-44721623 GCAGGAAAAGAGGTAGAATCTGG - Intergenic
1082872785 11:57958924-57958946 CAAGGTCAAGAGGCTGAATCTGG - Intergenic
1083240674 11:61385829-61385851 ACAGGTACTGAGAGTGAATCTGG + Intergenic
1086983913 11:93227664-93227686 CCAGCCAAAGACATGGAATCAGG - Intergenic
1087442669 11:98206894-98206916 CCAGGTAGAGAGATGGAGTGGGG - Intergenic
1088544660 11:110947371-110947393 CCAGGCAAAGCCATTGTATCTGG - Intergenic
1089088233 11:115842254-115842276 CCAGCTAAAGAGATAGACTATGG - Intergenic
1090023164 11:123145554-123145576 GCAGGAAAATAGCTTGAATCCGG - Intronic
1093809767 12:23477203-23477225 CCAGGTAATGAGATTGAAACAGG + Intergenic
1094583788 12:31758491-31758513 GCAGGTAATGGGAATGAATCAGG - Intergenic
1095573057 12:43704431-43704453 CCAGGTAATGAAAGTGAATAGGG + Intergenic
1096464227 12:51839306-51839328 CTAGCTGAAGAGATGGAATCGGG - Intergenic
1096676332 12:53228111-53228133 GATGGTAAAGAGTTTGAATCTGG - Intronic
1096802261 12:54118693-54118715 CCAGGCAAGGAGATGGAAACTGG + Intergenic
1097579624 12:61438801-61438823 CCAGGTACAAAGCTTGACTCTGG + Intergenic
1097873526 12:64622142-64622164 GCAGGAAAATAGCTTGAATCTGG - Intronic
1108632368 13:52298793-52298815 AGAAGTAATGAGATTGAATCAGG - Intergenic
1108654334 13:52513800-52513822 AGAAGTAATGAGATTGAATCAGG + Intergenic
1109247686 13:59976555-59976577 ACAGGAAAAGAGGTTGAATATGG - Intronic
1110167379 13:72460016-72460038 TCAGGGAAAGAAATGGAATCAGG + Intergenic
1110952856 13:81517386-81517408 CCAGGTAATGAAAGTGAATAAGG - Intergenic
1112621084 13:101054605-101054627 CCAGGCAAAGAAATGGACTCAGG - Exonic
1117077526 14:52119196-52119218 CAAGGTCAACAGATTGAATGTGG - Intergenic
1119769906 14:77214046-77214068 GAAGGTAAAGGGATTGAAGCAGG - Intronic
1120620727 14:86761272-86761294 GCAGGAGAAGAGCTTGAATCTGG - Intergenic
1124123238 15:26910504-26910526 GCAGGAAAAGAGCTTGAACCTGG + Intronic
1124616530 15:31246145-31246167 CAAAGCAAAGAGGTTGAATCTGG - Intergenic
1127146554 15:56030811-56030833 GCAGGTGAAGGGATGGAATCCGG - Intergenic
1127699942 15:61489163-61489185 CCAGGAGAATAGATTGAACCTGG + Intergenic
1128840822 15:70850189-70850211 ACAAGTAAGGAGATTGAATCAGG + Intronic
1129185764 15:73905481-73905503 CAAGGTAAAGTGCCTGAATCCGG - Intergenic
1129527742 15:76232306-76232328 CCTGGTAAACAGAATGAAGCAGG - Intronic
1129628316 15:77229739-77229761 GCAGGAGAATAGATTGAATCCGG - Intronic
1130727336 15:86452849-86452871 CAGGGCAAAGAGAATGAATCTGG - Intronic
1132919236 16:2376207-2376229 CTAGATACAGAGTTTGAATCAGG - Intergenic
1135264289 16:21009339-21009361 CCATGTAAAGAGATGAAATCAGG + Intronic
1137516787 16:49151927-49151949 ATGAGTAAAGAGATTGAATCAGG + Intergenic
1137618753 16:49862081-49862103 GCAGGTAAATTGTTTGAATCTGG - Intergenic
1139678770 16:68543652-68543674 GCAGGAAAATAGCTTGAATCAGG - Intronic
1140931794 16:79634751-79634773 ACAGGTAAAGAGAAGGATTCAGG + Intergenic
1141257650 16:82417746-82417768 CCAGGTAAAGGGATGGAATATGG - Intergenic
1141820386 16:86441662-86441684 CCGGATAAAGAGGTTGAAGCGGG + Intergenic
1142347411 16:89562727-89562749 CCAGGGAAGGTGATTGACTCAGG + Intronic
1142646289 17:1315827-1315849 CCAGGTAATGGGATTGAACCCGG + Intergenic
1142913533 17:3114991-3115013 CCAGGAGAAGAGATGGAATGGGG + Intergenic
1146624161 17:34423313-34423335 CCAGGTAAAGAGGCTGCATTTGG - Intergenic
1149159160 17:53669052-53669074 CCAGGTAGAGAAAAAGAATCAGG + Intergenic
1149637986 17:58185548-58185570 GCAGATAAAGAGATCTAATCAGG + Intergenic
1149926768 17:60709117-60709139 ACAGGTGTAAAGATTGAATCAGG + Intronic
1150746095 17:67817914-67817936 TCAGTTAAAGAGACTCAATCAGG + Intergenic
1151650119 17:75462255-75462277 CGAGGTAAAGAGATCGAGACCGG - Intronic
1151796253 17:76347904-76347926 GCAGGTAAAGGGGTAGAATCTGG + Intronic
1152269844 17:79317836-79317858 GCAGGCAAAGAGATTCGATCTGG + Intronic
1153980744 18:10307464-10307486 CAAGGTAAAGGGACTGCATCTGG - Intergenic
1155733631 18:29193593-29193615 CCATTTAAAGAAAATGAATCTGG + Intergenic
1155939421 18:31788956-31788978 CCAGGTAGAGAAATTGACTTGGG + Intergenic
1156555255 18:38060576-38060598 CCAGTTAAATACATGGAATCAGG - Intergenic
1158679502 18:59554301-59554323 CCAGGTCAAAAGCTTGAATCTGG + Intronic
1159197469 18:65136454-65136476 CCAGGAAAGGAGATTAAATGAGG + Intergenic
1161152451 19:2716846-2716868 CCAGGGAAAGAGATGGAAACGGG + Exonic
1162717744 19:12644498-12644520 CCAGGAAGAGAGATTGGACCTGG - Intronic
1162727985 19:12701307-12701329 CCAGGTAAGGAGACTGCAGCTGG - Exonic
1166234649 19:41446704-41446726 CCAAGTAAAGAAAGTGAATGAGG + Intergenic
1167049508 19:47069815-47069837 CCAGGAAAAGAGAATGAAACGGG + Intronic
1167827227 19:51985076-51985098 CCAGGTCAAGAAATAGAATATGG - Intronic
926045288 2:9705334-9705356 CAATGGAAAGTGATTGAATCAGG + Intergenic
926987439 2:18639808-18639830 CCAGGAGGAGAGAATGAATCAGG + Intergenic
928156939 2:28885414-28885436 GGAGGTAAGGAGATTGAATGAGG + Intergenic
929803016 2:45120529-45120551 CTAGGTAAAGTGATTCAATATGG - Intergenic
931118880 2:59194960-59194982 CCAGGTAGAGACAATGAAACAGG + Intergenic
934514280 2:94975389-94975411 GTAGGTAAAGACATTGAATTTGG - Intergenic
936497518 2:113035205-113035227 CCATGAAAAGAATTTGAATCTGG + Intronic
936659994 2:114532492-114532514 CCAGGTAAAGAATTAGAATATGG + Intronic
936767398 2:115869980-115870002 ACAGGTAAGGAAATTGAAGCAGG + Intergenic
939253252 2:139710727-139710749 CCAGGCAAAAAGATTAAATTTGG + Intergenic
939678188 2:145098002-145098024 ACAAGTAAAGAGATTGAGTTTGG - Intergenic
939678432 2:145100886-145100908 ACAAGTAAAGAGATTGAGTTGGG + Intergenic
940450080 2:153826128-153826150 CCAGGTCAAGGGCTTGCATCTGG + Intergenic
941386958 2:164865553-164865575 TTAGGTAAAAAGAATGAATCAGG - Intergenic
945766181 2:213980133-213980155 CGAGGTCAAGAGATTGAGTCTGG + Intronic
946240457 2:218351080-218351102 CCAGGTAAAGAAAGTGAGTAAGG - Intergenic
946560010 2:220901961-220901983 CCAGGTATTGAGATATAATCAGG - Intergenic
947986253 2:234450099-234450121 GCAGGTAAGGAGATTGGACCGGG - Intergenic
948245842 2:236485415-236485437 CCAGGTAAAAATGTTGAAACAGG - Intronic
948789702 2:240370903-240370925 GCAGGAGAAGAGATTGAACCCGG + Intergenic
1169161173 20:3379758-3379780 CCAGGTAAAAAGATAAAAACAGG + Intronic
1169801196 20:9514419-9514441 CCTGGTAAGGAGATTTAATAAGG + Exonic
1170338234 20:15294799-15294821 CCAGGTAAAGATATTTTAACTGG - Intronic
1171794470 20:29555894-29555916 CCAGGCAAGGAGATGGAAACTGG - Intergenic
1171853996 20:30328497-30328519 CCAGGCAAGGAGATGGAAACTGG + Intergenic
1177735804 21:25087206-25087228 CCAGGTAAAGTGTTTGAATAGGG - Intergenic
1177794437 21:25758817-25758839 CCATGTAAAGAAATTGGATGAGG + Intronic
1178571792 21:33744904-33744926 ACAGGTAAAGGGAAAGAATCAGG + Intronic
1180778535 22:18505973-18505995 TCAAGTAAAGAGATTGGATGAGG + Intergenic
1182584322 22:31335239-31335261 CCAGGGAAGGAGGTTGAGTCTGG - Intronic
949181521 3:1136868-1136890 ACAGGTGAAGAGACTGAAACTGG - Intronic
953593028 3:44278500-44278522 ACAAGTAATGAGATTGCATCAGG - Intronic
956650197 3:71497934-71497956 CTAGGAAAACAGATTGAATATGG - Intronic
957612969 3:82492606-82492628 CCAGATCAAGAGATTGAACTGGG + Intergenic
960099384 3:113724031-113724053 ACAGTTGAAAAGATTGAATCAGG - Exonic
963738749 3:149053048-149053070 CCAGGTAAAGGAATAGAACCTGG - Intronic
964245183 3:154643566-154643588 TCTGGGAAAGAGATTGAAACGGG - Intergenic
964987869 3:162766569-162766591 ACAGGAAGAGAGATTCAATCTGG + Intergenic
965641603 3:170834704-170834726 CAAGGTCAGCAGATTGAATCAGG - Intronic
966155598 3:176913066-176913088 CCAGTTAAAGAAATTGAAACTGG - Intergenic
967542482 3:190683766-190683788 CCAGGTAATGAAAGTGAATAGGG + Intergenic
970123974 4:12788775-12788797 GCAGGGAAAGAGCTTGAACCTGG + Intergenic
970331223 4:14986392-14986414 GCAGATAAGGAGATTGAAACTGG - Intergenic
970367409 4:15373762-15373784 CCAGGAAATGAGATAGAATATGG - Intronic
970762601 4:19509398-19509420 GCAGGAAAATAGCTTGAATCTGG - Intergenic
972992362 4:44836382-44836404 CCAGGAAAATCGATTGAACCTGG - Intergenic
973890006 4:55359403-55359425 CCAGGAACAGAGATTGAGTAAGG - Exonic
979327629 4:119397888-119397910 CCAGGTCAAGAGAGAGCATCAGG - Intergenic
979656144 4:123196664-123196686 CTAGGTATAGAGATTGGATGAGG + Intronic
980698305 4:136389607-136389629 CCAGGTACTGAGCTTGAATCTGG + Intergenic
982866081 4:160513470-160513492 GCAAGTAAAGAGACTGTATCAGG + Intergenic
982963389 4:161869916-161869938 AGAGGTAAAGAGATTGAAGGTGG - Intronic
983245381 4:165281614-165281636 CCAGGTCAAGAGAGAGCATCAGG - Intronic
983910359 4:173232227-173232249 CCAGGCAAAGAGTTTGAGCCTGG + Intronic
984166782 4:176312453-176312475 CCATGTAAAGGGAATAAATCAGG - Intergenic
985940631 5:3132970-3132992 GCAGGTAAACAGTTTGCATCTGG + Intergenic
986982961 5:13470018-13470040 CAGGGTAAAGAGACTGAAACAGG + Intergenic
987035735 5:14016668-14016690 GCAGGCAAAGACATTGAAACAGG - Intergenic
987748107 5:22004069-22004091 CAAGATAAATACATTGAATCTGG - Intronic
989055978 5:37366948-37366970 CGAGGTCAAGAGATTGAGACCGG - Intronic
989388642 5:40877887-40877909 GCAGGTAATCAGAATGAATCAGG + Intergenic
989511249 5:42289969-42289991 CCAGGAATAGAGATGGAAGCTGG - Intergenic
990240289 5:53810292-53810314 ACAGATAAAGAAATTGAGTCTGG - Intergenic
990879147 5:60520519-60520541 CAAGATAAAGAGAGTGAATGAGG - Intronic
991186870 5:63818798-63818820 GCAGGGAAATAGCTTGAATCCGG + Intergenic
992494700 5:77281167-77281189 CCAGGCAAACAGAATGAAACTGG - Intronic
993660998 5:90634943-90634965 CCAGGGAAGGAGATTGAAAAGGG + Intronic
993853189 5:93036944-93036966 ATAGGTAAATAGATTGGATCAGG - Intergenic
994471021 5:100207359-100207381 TCAGGAAAAGAGATAGAATATGG + Intergenic
995880746 5:116842183-116842205 CCTGTTTAAGATATTGAATCTGG + Intergenic
998255401 5:140583109-140583131 CCAGGTAAAGAGATTGAATCGGG + Intronic
999740155 5:154543774-154543796 GCAGGTAAATCGCTTGAATCAGG - Intergenic
1004260178 6:14101137-14101159 CCAGGGAAATAGACTGAAACGGG - Intergenic
1004393276 6:15226934-15226956 GCAGGAAAATAGCTTGAATCCGG - Intergenic
1005750202 6:28875083-28875105 GCAGGAAAAGAGCTTGAACCCGG + Intergenic
1006227803 6:32554983-32555005 AAAGGTAGAGAGAATGAATCAGG + Intronic
1010302326 6:74275520-74275542 CAAGGTGAAGAGGCTGAATCTGG - Intergenic
1010570703 6:77470796-77470818 CCAGGCAAAGAGATTGTACTGGG + Intergenic
1012521666 6:100127945-100127967 TTCGGCAAAGAGATTGAATCTGG + Intergenic
1012919397 6:105205856-105205878 CCAGGGAAAGAGAAAGAATAGGG - Intergenic
1015069234 6:129070070-129070092 ATAGGTAAAGAAATGGAATCTGG - Intronic
1015658704 6:135548477-135548499 CCAGGTAAACAGAATCAATAGGG + Intergenic
1015741313 6:136457282-136457304 AATAGTAAAGAGATTGAATCAGG + Intronic
1016960905 6:149671980-149672002 ACAGGAAAATAGCTTGAATCTGG - Intronic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1022350558 7:29563756-29563778 CCAGGGGAGGAGATTGGATCAGG - Intergenic
1023848533 7:44137882-44137904 CCAGGTACAGGGATTGCAGCAGG + Intergenic
1026310016 7:69175344-69175366 CCAGTTAAAGAGACAGAATAAGG - Intergenic
1026586310 7:71658792-71658814 GCAGGAAAATAGTTTGAATCTGG + Intronic
1028564107 7:92208691-92208713 CTCGGTAATGAGGTTGAATCAGG + Intronic
1029230927 7:99067858-99067880 CCAGGAAAATTGCTTGAATCTGG + Intronic
1029253183 7:99251248-99251270 CCAGGTAAAGAAATGGAGGCTGG + Intergenic
1031167649 7:118248801-118248823 CCAGGCAAAAAGAATGAAGCTGG - Intergenic
1031623897 7:123970058-123970080 CCATGTAAAGAAAGTGAACCCGG - Intronic
1031977988 7:128105814-128105836 CAAGGCAAAGAGATTAAATGTGG + Intergenic
1035905817 8:3509064-3509086 CCAGGTAAAGAGGAGGAAACTGG - Intronic
1036042321 8:5099464-5099486 CCAGATGAAGAAATTGAATGAGG - Intergenic
1036211381 8:6843868-6843890 CCTGCTAAAGAGATAGAATGGGG + Intergenic
1039374434 8:37019090-37019112 CCAGGGAAAGAGAAAGACTCAGG + Intergenic
1039448368 8:37650324-37650346 CCAGGCAGAGAGATTTCATCAGG + Intergenic
1039502640 8:38030020-38030042 CAAGGTCAAGAAATTGAAGCGGG + Intergenic
1039842177 8:41301965-41301987 CCTGGGAAAGAATTTGAATCTGG - Intronic
1041149054 8:54912874-54912896 ACAGGTAAAGATAATGATTCTGG - Intergenic
1041198602 8:55427009-55427031 CCAGGTAATAAAAGTGAATCAGG + Intronic
1042941912 8:74116556-74116578 CCATGTAAGGAGATTGCATGGGG + Intergenic
1045414749 8:101954469-101954491 AGAGGTAGAGAGAATGAATCAGG - Intronic
1045814928 8:106268887-106268909 TCAGGTAAAGCTATTGACTCGGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1052177615 9:25483075-25483097 CCAGGTAAACAGTTTGGATCAGG + Intergenic
1053082375 9:35187267-35187289 CCAGGTAATGAAAGTGAATAGGG - Intronic
1053272902 9:36762525-36762547 GCAGGTAAACAGCTTGAAGCTGG + Intergenic
1053510723 9:38685981-38686003 CCAGGCCAAGAGATTGAGTTTGG - Intergenic
1054153351 9:61622986-61623008 CCAGGCAAGGAGATGGAAACTGG - Intergenic
1054473150 9:65554191-65554213 CCAGGCAAGGAGATGGAAACTGG - Intergenic
1055283124 9:74697583-74697605 CCAGGTAAAAATATTTAACCAGG + Intergenic
1056108289 9:83369481-83369503 GCAGGAGAAGAGATTGAACCAGG + Intronic
1058177365 9:101752426-101752448 CCTGGTAAAGATAGTGAAACAGG - Intergenic
1058950536 9:109899543-109899565 ACAGGTAAAGGGTTTGAAGCTGG - Intronic
1059321634 9:113474986-113475008 CCAGCTAAAGAAATTCAGTCTGG - Intronic
1060090721 9:120740305-120740327 CCAGATAAGGAGCTTAAATCTGG + Intergenic
1062521364 9:136959295-136959317 CAGGGTAAAGAGATTCAATCTGG - Intergenic
1185535588 X:858944-858966 GGAGGTAAAGAGATAGAAACAGG - Intergenic
1188886243 X:35553488-35553510 GGAGGTAAAGAGAATAAATCTGG + Intergenic
1188928312 X:36073298-36073320 CCAGCCAAAGAGACTGAACCAGG - Exonic
1190336368 X:49265214-49265236 CCAGGGAAAGAGACAGAATAGGG + Intergenic
1193729513 X:85086198-85086220 CCAAGTGAAGAGATTGAAGGAGG - Intronic
1195686445 X:107591062-107591084 TCAGGAAAAGAAATTGAATTAGG - Intronic
1195979660 X:110563766-110563788 ACAGGTACAGAGATTCAATTTGG - Intergenic
1197444494 X:126533567-126533589 GCAGGCAAGGAGATAGAATCAGG + Intergenic
1198967176 X:142239667-142239689 CTGGGTAAAGAGCTTGAATTAGG + Intergenic