ID: 998256360

View in Genome Browser
Species Human (GRCh38)
Location 5:140591680-140591702
Sequence GGGACACGTCCAGCACCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998256350_998256360 19 Left 998256350 5:140591638-140591660 CCCTCAGACTCCACTGGGCCCTG 0: 1
1: 0
2: 2
3: 31
4: 273
Right 998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 59
998256352_998256360 9 Left 998256352 5:140591648-140591670 CCACTGGGCCCTGAACACTCACA 0: 1
1: 1
2: 1
3: 21
4: 245
Right 998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 59
998256354_998256360 0 Left 998256354 5:140591657-140591679 CCTGAACACTCACAAGCCCAGAG 0: 1
1: 0
2: 2
3: 26
4: 207
Right 998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 59
998256351_998256360 18 Left 998256351 5:140591639-140591661 CCTCAGACTCCACTGGGCCCTGA 0: 1
1: 0
2: 2
3: 35
4: 351
Right 998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 59
998256353_998256360 1 Left 998256353 5:140591656-140591678 CCCTGAACACTCACAAGCCCAGA 0: 1
1: 0
2: 0
3: 31
4: 200
Right 998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998256360 Original CRISPR GGGACACGTCCAGCACCGAC AGG Intronic
900226493 1:1535739-1535761 CGGAGGCGTCCACCACCGACTGG + Exonic
900724602 1:4207812-4207834 GGGATACCTCCTGCACCAACAGG - Intergenic
900854614 1:5170941-5170963 GGGCCAAGTCCAGCACCCTCAGG + Intergenic
901254511 1:7810540-7810562 GGGACACGCACAGAACCGAATGG + Exonic
904333052 1:29777838-29777860 GGGTCATGGCCAGCACCGAGAGG - Intergenic
905345032 1:37305623-37305645 GGGAAGCCTCCAGCACCCACTGG - Intergenic
911674321 1:100642230-100642252 GGTACAAGTCCAGAACTGACTGG + Intergenic
916108646 1:161447917-161447939 GGGACACGGCCGGCGCCGACGGG + Intergenic
916110234 1:161455298-161455320 GGGACACGGCCGGCGCCGACGGG + Intergenic
916111819 1:161462708-161462730 GGGACACGGCCGGCGCCGACGGG + Intergenic
916113406 1:161470089-161470111 GGGACACGGCCGGCGCCGACGGG + Intergenic
919756078 1:201066906-201066928 GGGACACGGCCACCACCAGCAGG + Exonic
920843629 1:209575654-209575676 GGGACACATCCAGCCCCAGCTGG - Intergenic
1070890717 10:79940729-79940751 GGGACAAGTACAGCACCTCCAGG - Exonic
1084521703 11:69667044-69667066 GAGGCACGTCCCGCACCGCCTGG + Exonic
1087709167 11:101530026-101530048 GTGACAGGTCCACCACCCACAGG + Intronic
1104903976 12:132203795-132203817 GGGGCACCCCCACCACCGACGGG + Intronic
1117577158 14:57110896-57110918 GGGACACGTGCAGAACCTGCAGG - Intergenic
1118108857 14:62693836-62693858 GGGACTCCTCCCTCACCGACGGG - Intergenic
1118323688 14:64767845-64767867 GGCACACCTCCAGCACTGCCAGG + Exonic
1118496876 14:66315910-66315932 GGGACAGGTGCAGCAGCAACTGG - Intergenic
1118859814 14:69654043-69654065 GGGACAGGTGCAGAACAGACGGG - Intronic
1121013436 14:90534813-90534835 GTGACAGGCCCAGCACGGACAGG + Exonic
1134548930 16:15130381-15130403 CGGACACCTCCAGCGCCGACAGG + Intronic
1137454765 16:48609942-48609964 TGAACTCGTCCAGCACCGCCCGG + Exonic
1139467825 16:67163715-67163737 GGAAGGCGTCCAGCACCGAGTGG - Exonic
1143317162 17:6041409-6041431 GGAAACCGTCCAGCACCGTCTGG + Intronic
1160708960 19:541993-542015 GAGCCACGTCCAGCACAGAGTGG + Exonic
1161699492 19:5787156-5787178 GCGGCACATCCAGCACCTACAGG + Exonic
1164605339 19:29593907-29593929 GGGGAACCTCCAGCACCGGCAGG + Intergenic
1167509758 19:49889817-49889839 CGGACACGGCCAGCCCCGAGGGG - Exonic
926218968 2:10922682-10922704 GGGACATGGCCAGGACCCACTGG - Intergenic
933689648 2:85169812-85169834 CAGACTCGTCCAGCACAGACTGG + Intronic
938736851 2:134193534-134193556 GGGGCATGTCCACCACCGCCTGG - Intronic
948363309 2:237437733-237437755 TGGACAGGTGCAGCACCCACCGG - Intergenic
1169140302 20:3223935-3223957 GGGACACGGGCAGCACCGTGTGG + Intergenic
1171767449 20:29297886-29297908 GGAACCCGGCCAGCCCCGACAGG + Intergenic
1175258732 20:57662222-57662244 GGTAACCGTCCTGCACCGACAGG + Intronic
1175861232 20:62151433-62151455 GGGCCAAGCCCAGCACCCACAGG - Intronic
1175894432 20:62329830-62329852 GGGTCACGTCCAGCAGGGCCTGG + Exonic
1175911208 20:62406387-62406409 GGGGCATGTCCAGAACCCACAGG + Intronic
1176143726 20:63556206-63556228 GCTACACGTCAAGCACCGCCTGG + Exonic
1178948255 21:36966203-36966225 GTCACGCGTCCAGCACCGCCCGG + Intronic
1179926316 21:44536196-44536218 GGGAGAAGCCCAGCACCGCCCGG - Intronic
1180693851 22:17739589-17739611 GGGACAAGGCCAGCCCCCACTGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184785160 22:46668134-46668156 GGGCGACGTCCAGCACCAGCTGG - Exonic
949414677 3:3800994-3801016 GGGAAAAGTCCAGCAGCGAGAGG + Intronic
968473020 4:790529-790551 GGGACAGGGCCAGCAGCGTCAGG - Intronic
973926930 4:55748265-55748287 GGGACACCTCCTCCACAGACAGG + Intergenic
979156848 4:117404825-117404847 GGGACACGTGCAGAACGTACAGG + Intergenic
989776298 5:45211921-45211943 GGCACATTTCCAGCACCTACTGG + Intergenic
998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG + Intronic
999430465 5:151521328-151521350 GGCCCACGTACAGCACCGCCAGG - Exonic
1001564213 5:172689017-172689039 GGGTCACGTCCAGCCTCCACTGG + Exonic
1002182128 5:177436097-177436119 GGTACACGTTCAGCCCTGACTGG + Exonic
1015836091 6:137421476-137421498 GAGACACCTTCAGCACCGACTGG - Intergenic
1036453930 8:8892422-8892444 TGGACACGTCCAGCTCCTCCAGG + Exonic
1039461551 8:37749724-37749746 GGGACACACCCAGCTCCCACTGG - Intronic
1042842327 8:73136467-73136489 GTGAGACATCCAGCACTGACTGG + Intergenic
1048292249 8:133190050-133190072 GGGACAGCTCCAGCACCAAACGG + Intergenic
1049099117 8:140566797-140566819 GGGACAATTCCAGTACGGACTGG + Intronic
1049204481 8:141357356-141357378 CTGTCACGCCCAGCACCGACAGG + Exonic
1056740919 9:89254914-89254936 GGGACAGGTGCAGCACCGCTTGG - Intergenic
1058703619 9:107621023-107621045 GGAACACCACCAGCACAGACCGG - Intergenic
1060521160 9:124294896-124294918 GGGACAAGGCCAGCACAGAGTGG + Intronic