ID: 998261177

View in Genome Browser
Species Human (GRCh38)
Location 5:140633015-140633037
Sequence CAACCCCTGTGGCTCCCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998261169_998261177 12 Left 998261169 5:140632980-140633002 CCTGGGGAGAGAGCAGAGGTCTA 0: 1
1: 0
2: 1
3: 31
4: 294
Right 998261177 5:140633015-140633037 CAACCCCTGTGGCTCCCGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998261177 Original CRISPR CAACCCCTGTGGCTCCCGAG TGG Intronic
900176787 1:1294656-1294678 CAACCCCCGGGGCTGCCCAGGGG + Intronic
900401814 1:2475840-2475862 CAGCCCCTGTGGCTGGAGAGGGG - Intronic
900854846 1:5172605-5172627 CATCCCCTGTGGCTCCAGACTGG + Intergenic
902551811 1:17223839-17223861 CAATCCCTGTGGTTCCAGAGTGG - Intronic
903653744 1:24936329-24936351 CTACCCCTGTGGTTTCCCAGTGG - Intronic
905860832 1:41350046-41350068 CCACCCCTGTGGCTCCACAGGGG + Intergenic
905992688 1:42353081-42353103 CAGCCCCTGGGGCTCCCCAGGGG - Intergenic
906476178 1:46171168-46171190 CAACCCCTGAGCCTCGGGAGAGG - Intronic
907248883 1:53124838-53124860 CAAACTCTGTGCCTCCCGAGTGG + Intronic
910245728 1:85136250-85136272 CATCACCTGTGGCCACCGAGAGG + Intergenic
912235406 1:107844988-107845010 TGACCCCTGTGCCTCCTGAGTGG + Intronic
914474436 1:148011707-148011729 CAACCACTGTGGCATCCGCGGGG + Intergenic
915225362 1:154407324-154407346 CACCACCTGTTGCTCCTGAGTGG + Intronic
917687466 1:177431845-177431867 CAACCCATGTCCCTCCCCAGAGG - Intergenic
919673108 1:200355748-200355770 CATCCCCTCTGGCTTCCCAGGGG + Intergenic
919847279 1:201649910-201649932 CTTCCTCTGTGGATCCCGAGTGG + Intronic
921355412 1:214280951-214280973 CAGCCCCTGTGGCTTCTGCGAGG - Intergenic
921839732 1:219815663-219815685 CAACCCCTGTGCTACCCGAAGGG + Intronic
923335432 1:232965835-232965857 GAGCCCCTGTGAGTCCCGAGAGG + Intronic
1063162817 10:3431853-3431875 CAATCCCTGTGGCCGCCGTGTGG - Intergenic
1064673535 10:17739251-17739273 AAGCCCCTGTGGCTCACCAGGGG - Intergenic
1067524229 10:47028579-47028601 CAGCCCCTGTGCCTCCCTGGAGG - Intergenic
1069047790 10:63761485-63761507 TTACCCCTGTGGCTCTCTAGAGG - Intergenic
1069777103 10:70933649-70933671 CAGCCCCTGTGGCTCCCCAAAGG + Intergenic
1072690746 10:97570962-97570984 CAAGCCCTGGGGCTCACGGGTGG - Exonic
1074985105 10:118651731-118651753 TAACCCCTGTGCCTCCTGACTGG - Intergenic
1075414231 10:122250475-122250497 AAATCCATGTGCCTCCCGAGTGG + Intronic
1078067917 11:8090049-8090071 CAACCTCTGTGCCTCCATAGCGG + Exonic
1084472300 11:69370115-69370137 CAACCCCTGTGGCTGACCAGTGG + Intergenic
1084791790 11:71479713-71479735 CAATCCCTGTGGATACCAAGGGG - Intronic
1089492408 11:118892293-118892315 CCACAACTGTGGCTCCTGAGAGG + Intronic
1090525382 11:127528915-127528937 CAACCCCAGTGCTTCCCGTGAGG + Intergenic
1101820884 12:108183620-108183642 GAACCCCTGTGCCTTCTGAGCGG + Intronic
1101921373 12:108935962-108935984 CCACCCCTGTGGTACCCAAGGGG + Intronic
1103169088 12:118798590-118798612 TAACCCCTGTGCCTCCTGACTGG - Intergenic
1103617972 12:122167091-122167113 CAGCCCCTGTTCCTCCAGAGAGG + Intergenic
1104802936 12:131566968-131566990 CTGCCCCTGTGGCCCCCGTGAGG + Intergenic
1106614780 13:31316304-31316326 CCACCCCTGTGGCTCTGCAGGGG - Intronic
1108160309 13:47632222-47632244 CAGCCCCTGTGGCTCTCAGGTGG - Intergenic
1111721916 13:91956385-91956407 AAAACCCTGTGCCTCCCAAGAGG - Intronic
1115974338 14:38980649-38980671 TGACCCCTGTGGCTCCTGACGGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1122218804 14:100222254-100222276 CCACCCCTGGGGCTCCCCTGTGG - Intergenic
1122722168 14:103728230-103728252 CAACCACTGTGGCTCCTCGGAGG + Intronic
1123676512 15:22714870-22714892 CAGCCGCTGTGGCGCCCGGGCGG - Intergenic
1124899221 15:33807101-33807123 CAACATCTGTGGCTACAGAGAGG - Intronic
1129499081 15:76018786-76018808 TAACCCCTGTGTCTCCTGACGGG - Intronic
1129695656 15:77739410-77739432 CAGCCCCTGAGGCCCCCAAGGGG - Intronic
1131184012 15:90259984-90260006 CAGGCCCTGTGGCTCTCGTGGGG - Intronic
1131392650 15:92061856-92061878 AAACCCTTGTGGCTCCCAAAGGG - Intronic
1133007838 16:2894579-2894601 CAACCCCTGTTCCTCCCGTGCGG - Intronic
1133801771 16:9091077-9091099 CAGCCCCTGGGGCTCCCAAAGGG - Intergenic
1137848535 16:51715280-51715302 CAATCCCTGGGGCTCCTCAGGGG - Intergenic
1138228728 16:55323178-55323200 CAACCCCTATGGCTCCTTGGAGG + Intergenic
1140130369 16:72155591-72155613 CAATCTCATTGGCTCCCGAGGGG + Intronic
1141470600 16:84235931-84235953 CAGACCATCTGGCTCCCGAGTGG + Intronic
1144497467 17:15757589-15757611 CCAGCCCTGTGGCTCCTTAGAGG + Intergenic
1144629260 17:16862073-16862095 CCAGCCCTGTGGCTCCTTAGAGG + Intergenic
1144652166 17:17014042-17014064 CCAGCCCTGTGGCTCCTTAGAGG - Intergenic
1145160831 17:20572639-20572661 CCAGCCCTGTGGCTCCTTAGAGG + Intergenic
1147552631 17:41455174-41455196 CCAGCCCTCTGGCTCCAGAGCGG - Intergenic
1149342092 17:55697890-55697912 GAACCCCTCTGGCTCCTGATGGG + Intergenic
1151230851 17:72684097-72684119 AGAGCCCTGTGGCTCCCCAGGGG - Intronic
1152123155 17:78431312-78431334 CAGCGTCTGTGTCTCCCGAGAGG + Intronic
1155067793 18:22283179-22283201 CAACCCCAGTGGCTCAAAAGAGG - Intergenic
1157698596 18:49745015-49745037 CCACCCATGTGGCTCCAGTGGGG - Intergenic
1158680509 18:59562450-59562472 CAGACCTTGTGGCTCCAGAGAGG + Intronic
1160810559 19:1011247-1011269 CAGCCCCTGGGGTTCCCGCGTGG + Intronic
1161043057 19:2120378-2120400 AGACCCCTGTGCCTCCAGAGGGG + Intronic
1161397631 19:4052801-4052823 CAAGTCCTGTGGCTCCCAGGGGG + Intronic
1165058798 19:33194959-33194981 CCACCGCGGTGGCTCCCGCGCGG + Intronic
1167728871 19:51238346-51238368 CAACCTCTGTGTCTCCCACGTGG - Intronic
925285892 2:2715561-2715583 GAACCCCTGTGGCTCCCCCACGG + Intergenic
925685888 2:6473086-6473108 CATCTCCTGTGGTTACCGAGAGG + Intergenic
932374830 2:71226695-71226717 AACCCCCTATTGCTCCCGAGGGG + Intronic
932586697 2:73034648-73034670 GAACCACTGTAGCTCCTGAGTGG - Intronic
933317958 2:80737501-80737523 TGACCCCTGTGGCTCCTGACAGG + Intergenic
941478107 2:165972458-165972480 TGACCCCTGTGGCTCCTGACTGG + Intergenic
942953625 2:181749996-181750018 TAACCCCTGTGCCTCCCGACTGG - Intergenic
944690711 2:202155989-202156011 CAGTCCCTGTGGCTCCAGGGTGG - Intronic
945984309 2:216341666-216341688 CAACACCGGTGCCTCCCGATGGG + Intronic
948109006 2:235439596-235439618 CAGCCCCCGTGGCTGCAGAGGGG + Intergenic
1173663938 20:44752321-44752343 CAACAGCTGTGCCTCCAGAGGGG + Intronic
1174665515 20:52254199-52254221 CAATCCCTCTGGCTGCTGAGTGG - Intergenic
1175045793 20:56103906-56103928 CATCCCCTGTTGCTACAGAGAGG - Intergenic
1175166708 20:57049122-57049144 CAGCCCCTGTCGCGCCCCAGAGG - Intergenic
1175545758 20:59776695-59776717 CCAGGCCTGAGGCTCCCGAGAGG - Intronic
1176117245 20:63438423-63438445 CAACCCCTGAGGCTGCACAGGGG - Intronic
1179173745 21:38992365-38992387 CAAGCCCTCTGGCCCCCCAGTGG + Intergenic
1179790250 21:43752281-43752303 CAAACCGTGTGGCTCCCCACAGG - Intronic
1184663597 22:45976490-45976512 CAACCCCCTGAGCTCCCGAGAGG - Intronic
1185131978 22:49044465-49044487 CAAACCCTGTGTATCTCGAGTGG + Intergenic
1185375752 22:50481981-50482003 CAACCCCTCTGGCCCCCGCAGGG + Intronic
949509775 3:4757872-4757894 CAACGCCAGTGGCTACCAAGAGG - Intronic
949806357 3:7959658-7959680 CAACCCCTGTGGCTCATGGTGGG - Intergenic
951676375 3:25246778-25246800 CAAACCCTGTGCCTCCTGATGGG - Intronic
951832230 3:26943278-26943300 TGACCCCTGTGGCTCCTGAATGG + Intergenic
952945710 3:38476929-38476951 CAACACCTGAGGCTCCTGCGTGG - Intronic
954700965 3:52450780-52450802 CAACCACTGTGGCAGCCTAGGGG - Intergenic
956574133 3:70732700-70732722 CAACTCCTGTGGATGCCCAGTGG + Intergenic
957039803 3:75328261-75328283 CCCCACCTGTGGCTCCCCAGAGG - Intergenic
957574042 3:81986470-81986492 CAAACCCTATTGCTCCCGGGGGG + Intergenic
961044553 3:123699695-123699717 CGCCACCTGTGGCTCCCCAGAGG - Intronic
964232555 3:154487482-154487504 CAACCCCCGTGACTCCTGACTGG + Intergenic
965532036 3:169780886-169780908 CAACCACTGTGGCTTCCTTGTGG - Intronic
968131850 3:196196727-196196749 CCACCCCAGAGGCTCCAGAGAGG + Intergenic
968808773 4:2790850-2790872 CTACCCTTGTGGCTCACGAGAGG - Intergenic
969164755 4:5298242-5298264 TAACCCCTGTGCCTCCTGACTGG - Intronic
969400504 4:6952340-6952362 CAAACCCTGTGGTTCTCAAGTGG - Intronic
971429997 4:26555972-26555994 TAACCCCCGTGGCTCCTGACTGG - Intergenic
975763113 4:77636785-77636807 CAGCCCCTGAGGCTCCCAGGTGG - Intergenic
978090352 4:104707535-104707557 TGACCCCTGTGCCTCCTGAGAGG + Intergenic
979610262 4:122682235-122682257 CCACCCCTGTGGCTCTGCAGGGG - Intergenic
979978438 4:127225043-127225065 CTACCCCTGTGGCTCTCAGGTGG + Intergenic
981940035 4:150272043-150272065 CAACCCCTGTGTCTCCTGACTGG + Intronic
986685412 5:10271819-10271841 CATCCGCTGAGGCTCCCCAGAGG + Intergenic
990803573 5:59632426-59632448 TGACCCCTGTGCCTCCCGATAGG + Intronic
993381792 5:87217324-87217346 TGACCCCTGTGCCTCCGGAGTGG - Intergenic
997461438 5:134055187-134055209 CCACCCCTGTGGCTTCCTGGGGG - Intergenic
998261177 5:140633015-140633037 CAACCCCTGTGGCTCCCGAGTGG + Intronic
999286708 5:150398554-150398576 CAACCCCTGACGCCCCCGACTGG - Intronic
1002495642 5:179609557-179609579 CAAACCCTGTGGGTCTCCAGGGG + Exonic
1006588947 6:35140709-35140731 CAGTCCCTGTGGCCCCCTAGGGG - Intronic
1007545245 6:42688351-42688373 CTACTCCTGTGGCTCTGGAGTGG + Exonic
1009721466 6:67476115-67476137 CAAAGCCTTTGGCTCCAGAGTGG + Intergenic
1012083011 6:94784896-94784918 TGACCCCTGTGCCTCCTGAGAGG - Intergenic
1021144271 7:17065998-17066020 CAGCCGCTGTGGCTCCCGTTAGG + Intergenic
1021166938 7:17353904-17353926 TGACCCCTGTGCCTCCTGAGGGG - Intergenic
1023994396 7:45150379-45150401 CGTCCCCTGTGGCTTCCGTGTGG + Intergenic
1024015549 7:45311444-45311466 ACAACCCTGTGGCTCCCAAGTGG + Intergenic
1026902016 7:74042734-74042756 CAAGCCCTCTGGCTTCCGTGGGG + Intronic
1029304331 7:99607587-99607609 CACCCCCTGTGGCTCCTGCCTGG - Intronic
1029442148 7:100592838-100592860 CACTTCCTGCGGCTCCCGAGTGG - Exonic
1035200031 7:157256845-157256867 CAATCCCTGTGGGTCCTGAAGGG + Intronic
1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG + Intronic
1036829967 8:12014046-12014068 AAACCCATGTGCCTCCCCAGTGG + Intronic
1038423115 8:27446196-27446218 CTACCCCTGGGGCTCAGGAGAGG - Intronic
1039814759 8:41083555-41083577 AAACCCCTGTGGCTCACCACAGG + Intergenic
1047121375 8:121908612-121908634 TGACCCCTGTGGCTCCTGACTGG + Intergenic
1048275129 8:133060119-133060141 CCACCCCTGCGCCTGCCGAGAGG - Exonic
1049072602 8:140368430-140368452 CTGCCCCTGTGGCTCCAGAGAGG + Intronic
1050963391 9:11766240-11766262 TAACCCCTGTGCCTCCTGACTGG + Intergenic
1052066868 9:24032822-24032844 CCACCCCTGAGGCACCTGAGCGG + Intergenic
1053479139 9:38403034-38403056 CAAAGCCTGAGGCTCCCAAGAGG + Intergenic
1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG + Intergenic
1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054368490 9:64368207-64368229 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054528233 9:66154300-66154322 CAACCACTATGGCCCCTGAGCGG - Intergenic
1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG + Intergenic
1055338915 9:75261419-75261441 TGACCCCTGTGCCTCCTGAGTGG - Intergenic
1057223102 9:93268298-93268320 CAGCCCCCGAAGCTCCCGAGAGG - Intronic
1061922447 9:133789473-133789495 CAGCCCCTGTGGCTCCCAGCTGG + Intronic
1062535667 9:137020144-137020166 CAGCCCCTGGAGCTCCCGAAAGG + Intronic
1187459644 X:19475401-19475423 CAACCCCTGGGCCACCCGACCGG - Intronic
1189039699 X:37529916-37529938 CGACCCCTGTGCCTCCTGACTGG - Intronic
1189126918 X:38458009-38458031 CAGCCCCTTTGGCTACCCAGAGG - Intronic
1192182423 X:68924538-68924560 CAACCCCAGTGGCTTCTCAGAGG + Intergenic
1192433761 X:71129663-71129685 CATCCCCTGTGGTTCACGGGTGG - Exonic
1195658472 X:107355804-107355826 AAACCCCTTTGCCTCCCCAGTGG - Intergenic
1197614234 X:128674470-128674492 TGACCCCTGTGCCTCCCGACTGG - Intergenic
1198683383 X:139204466-139204488 CAACCCCCGGGGCGGCCGAGAGG + Intronic