ID: 998261248

View in Genome Browser
Species Human (GRCh38)
Location 5:140633390-140633412
Sequence GATGACTCAGGCGCCCCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998261244_998261248 -9 Left 998261244 5:140633376-140633398 CCTGGCAGTGTCCTGATGACTCA 0: 1
1: 0
2: 1
3: 17
4: 200
Right 998261248 5:140633390-140633412 GATGACTCAGGCGCCCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998261248 Original CRISPR GATGACTCAGGCGCCCCAGG CGG Exonic
900086735 1:902187-902209 GGTGACTTAGCGGCCCCAGGAGG + Intergenic
900376245 1:2356082-2356104 GAGGACTCAGGGGCGGCAGGTGG + Intronic
901857494 1:12053669-12053691 GAACACACAGGCCCCCCAGGAGG + Intergenic
902360019 1:15937288-15937310 GATGCCTCAAGTGTCCCAGGAGG + Exonic
902846374 1:19113805-19113827 GATGACTCAGGAACAGCAGGGGG - Exonic
903496676 1:23773065-23773087 GACGATTCAGGTTCCCCAGGTGG + Intergenic
905544338 1:38785880-38785902 GATGGCTGAGGAGCCCCAGCTGG - Intergenic
914829226 1:151158535-151158557 GAGGACTGAGGGGCCCCAGGGGG + Intronic
916127136 1:161581549-161581571 GGTGAGTCAGGGCCCCCAGGAGG + Intronic
916137056 1:161663353-161663375 GGTGAGTCAGGGCCCCCAGGAGG + Exonic
1066262026 10:33738333-33738355 AGTGGCTCAGGGGCCCCAGGGGG + Intergenic
1073144429 10:101271252-101271274 GGGGAATCAGGAGCCCCAGGAGG + Intergenic
1074761581 10:116670473-116670495 GATGACTCACCTTCCCCAGGTGG - Intergenic
1077206920 11:1349234-1349256 GATGACTCCTGCGGCCCTGGAGG + Intergenic
1081687835 11:45055024-45055046 GATGAGTCAGAGGTCCCAGGAGG - Intergenic
1090274103 11:125407650-125407672 CATGACTCAGGAGGCTCAGGTGG + Intronic
1103810465 12:123609485-123609507 GATGACTCAGGAGGCTGAGGTGG - Intronic
1103890141 12:124232361-124232383 GATCTGTCAGGGGCCCCAGGTGG - Intronic
1104774234 12:131382669-131382691 GGTGGCTCAGCAGCCCCAGGAGG - Intergenic
1104774269 12:131382781-131382803 GGTGGCTCAGCAGCCCCAGGAGG - Intergenic
1104774400 12:131383232-131383254 GGTGGCTCAGCAGCCCCAGGAGG - Intergenic
1104774445 12:131383400-131383422 GGTGGCTCAGCAGCCCCAGGAGG - Intergenic
1105557298 13:21459236-21459258 GGTGACTCGGACGCTCCAGGCGG + Exonic
1106865122 13:33955816-33955838 GATGTCTCAGGGGCTTCAGGAGG + Intronic
1108463126 13:50687516-50687538 GGTGATTCAGTCGCCCCAGAAGG + Intronic
1114525471 14:23365121-23365143 CACGACTCAGGCGCCACAGCTGG - Exonic
1120730239 14:87993176-87993198 CATGACTCCGGCGCCCAGGGAGG + Exonic
1121712956 14:96052850-96052872 GATGACTCAGTTGACTCAGGAGG + Intronic
1122793339 14:104193582-104193604 GATGAAACAGGGCCCCCAGGAGG - Intergenic
1122805572 14:104254835-104254857 GAGAACTGAGGGGCCCCAGGGGG + Intergenic
1123058175 14:105582172-105582194 AATGACTCAGCCGCCCCACAGGG + Intergenic
1127137955 15:55944099-55944121 GATGAACCAGGCACCTCAGGTGG - Intronic
1127354250 15:58182806-58182828 GACCACTTAGGTGCCCCAGGTGG + Intronic
1129051577 15:72785669-72785691 GAAGAGTCAGGAGCCGCAGGAGG + Intronic
1129112476 15:73345543-73345565 AATGAGTCATGGGCCCCAGGAGG + Intronic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1135572286 16:23558057-23558079 GAGGACTCCGGCGCCGCACGAGG + Exonic
1139807865 16:69584674-69584696 AATTACTCAGGAGCCTCAGGCGG + Intronic
1142440952 16:90097183-90097205 GAGGACGCAGGCGTCCCAGGTGG + Intergenic
1143492356 17:7291887-7291909 GTTGACACAGGCACCCAAGGCGG + Intronic
1143865053 17:9917452-9917474 GAGGGCTCCGGGGCCCCAGGGGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151546295 17:74795324-74795346 AATGACTCAGGAGCCCTTGGTGG - Intronic
1151758222 17:76086751-76086773 TCTGACTCAGGCTCCCCAGTAGG + Intronic
1152522918 17:80870579-80870601 GATGACTCAGTCTCACCAAGGGG + Intronic
1152561331 17:81080228-81080250 GGTGCCGCAGGCGCCCCAGCCGG - Intronic
1154309175 18:13254269-13254291 GAGGAGTGAGGGGCCCCAGGTGG + Intronic
1156434407 18:37111639-37111661 GATGAACCAGGCGCCTCAGTTGG - Intronic
1157523533 18:48361783-48361805 GAGGACTCAGAAGCCCGAGGTGG + Intronic
1158367540 18:56755541-56755563 GATGAATCAGGAGGCCCAGGAGG + Intronic
1160949288 19:1657922-1657944 CCTGACTCAGGGGCCCCCGGGGG + Intergenic
1162827761 19:13264155-13264177 CATGACTCAGGCCCCCCAAGAGG + Intronic
1165725062 19:38106881-38106903 GATGACTCAAGAGGCCCTGGAGG - Intronic
1167143832 19:47670691-47670713 GATGACCCAGGAGGCCCAGGTGG - Intronic
1167527643 19:49994923-49994945 GAAGACACAAGCACCCCAGGAGG + Intronic
925109597 2:1322697-1322719 GATTACTCAGGTACCCCAGTAGG - Intronic
927135327 2:20092562-20092584 GATGAACCAGGCTCCCCATGAGG + Intergenic
927808838 2:26170963-26170985 GGTGACTCAGGCAGCCCAGATGG - Intergenic
932088990 2:68788145-68788167 GATGACCCAGGTGCCGCAGGGGG - Intronic
932705479 2:74021146-74021168 GGAGACTCAGAGGCCCCAGGTGG - Intronic
934025713 2:88000151-88000173 TATGAATCAGGGGACCCAGGAGG + Intergenic
942149167 2:173057531-173057553 GATGATTCAGTCTCCCCAGCAGG + Intergenic
945825391 2:214715360-214715382 AAAGACACAGGTGCCCCAGGGGG + Intergenic
947915716 2:233830614-233830636 GATGGCCCAGGTGGCCCAGGTGG + Intronic
948668426 2:239551000-239551022 GATGACGCAGCCTCCCCAGGTGG - Intergenic
1169497072 20:6125250-6125272 GATGTCTCAGGCTCCCAAGCTGG + Intergenic
1170438360 20:16352804-16352826 GAGGCCTGAGGGGCCCCAGGAGG - Intronic
1170896221 20:20417087-20417109 GATGGCTGAAGCGTCCCAGGTGG - Intronic
1173925012 20:46774472-46774494 GATAACTCAAGCGTGCCAGGGGG + Intergenic
1177491113 21:21827479-21827501 GATGACCCAGGTGGCCCAGTTGG - Intergenic
1179518699 21:41927883-41927905 GTTGACGCAGGAGCCCCACGTGG - Intronic
1180159792 21:45993920-45993942 GACGCCTCTGGGGCCCCAGGAGG + Intronic
1184455727 22:44608578-44608600 GATGCCTGTGGAGCCCCAGGAGG - Intergenic
950345368 3:12287955-12287977 GCCGACCCAAGCGCCCCAGGCGG - Intronic
950710403 3:14809846-14809868 GATGACTCAGACCTGCCAGGTGG - Intergenic
951871762 3:27369469-27369491 ATTGGCTGAGGCGCCCCAGGTGG - Intergenic
959940427 3:112075423-112075445 GATGACTGAGGCACCACAGTAGG - Exonic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
977607361 4:98996031-98996053 GAGGACCCAGGGACCCCAGGAGG - Intronic
980213715 4:129823296-129823318 AATGACTCAGATGCCCCAAGAGG - Intergenic
981570608 4:146146979-146147001 GATGACTCAGGTGGGCCAAGAGG + Intergenic
986626063 5:9725023-9725045 GGTGACTCAGGTGGCCCATGTGG - Intergenic
994125530 5:96166089-96166111 GAAGACTCAGGAGCGCCATGTGG - Intergenic
994140196 5:96333378-96333400 GTTGACTTAGACGCCCTAGGTGG + Intergenic
997177780 5:131796994-131797016 TATGACTGAGGCGCCCATGGGGG - Exonic
998261248 5:140633390-140633412 GATGACTCAGGCGCCCCAGGCGG + Exonic
1001781936 5:174376234-174376256 GAGGACTCTAGCGCTCCAGGGGG + Intergenic
1003970958 6:11298951-11298973 GATGAATCAGGTGCCTCAGTTGG - Intronic
1005268633 6:24139808-24139830 GAGGACTCAGGAGCCTGAGGAGG + Intronic
1006401471 6:33820460-33820482 GTGGCCTCAGGCTCCCCAGGAGG + Intergenic
1017024856 6:150172798-150172820 GATGACTCCTCCTCCCCAGGAGG + Intronic
1019254474 7:40551-40573 GAGGGCGCAGGAGCCCCAGGTGG - Intergenic
1020130420 7:5556098-5556120 GCTGACTCACGCTCCCCAGTGGG - Intronic
1024430380 7:49281989-49282011 GATGTCTGAGGAGCCCAAGGAGG + Intergenic
1026541274 7:71282055-71282077 GATGGCACAGGAGCCCAAGGGGG - Intronic
1026983205 7:74538451-74538473 GGTGACTGAGGCCCCCCAGAGGG - Intronic
1032197206 7:129796362-129796384 GAGGACTCAGGCTCCCCAAAGGG + Intergenic
1033684051 7:143622712-143622734 CATGACTCAGCCTCCCCAAGTGG + Intronic
1033687227 7:143701931-143701953 CATGACTCAGCCTCCCCAAGTGG + Intronic
1033700561 7:143834911-143834933 CATGACTCAGCCTCCCCAAGTGG - Intergenic
1034277352 7:149829672-149829694 GATGACTGAGGGGACACAGGAGG - Intergenic
1034533408 7:151711977-151711999 GGTTTCCCAGGCGCCCCAGGTGG + Intronic
1037832829 8:22199245-22199267 TCTGACTCTGGCCCCCCAGGAGG + Intronic
1037843572 8:22262956-22262978 GAGGCCCCAGGGGCCCCAGGAGG - Intergenic
1041176640 8:55203633-55203655 GCTGAGTCAGGTTCCCCAGGTGG - Intronic
1041846093 8:62330594-62330616 GATCACTCAGTCGCTCCAGATGG + Intronic
1043401854 8:79891934-79891956 GAGGCCACAGGCGCCCCGGGAGG - Intergenic
1043401878 8:79891991-79892013 GAGGCCACAGGCGCCCCGGGAGG - Intergenic
1043401890 8:79892020-79892042 GAGGTCACAGGCGCCCCAGGAGG - Intergenic
1049104434 8:140603138-140603160 GTTGACTCAGGCCCCCACGGCGG + Intronic
1049279716 8:141738106-141738128 GAGGACCCAGGAGCCCCGGGGGG + Intergenic
1049341545 8:142115124-142115146 TAGGACCCAGGAGCCCCAGGAGG - Intergenic
1056521618 9:87407312-87407334 GATGACACATGTGCCCAAGGTGG - Intergenic
1059383738 9:113948368-113948390 GAAGACTCAGGGGCACGAGGTGG - Intronic
1059576816 9:115498248-115498270 GATGACCCAGCTGACCCAGGTGG - Intergenic
1059703726 9:116800566-116800588 GAGGACCCAGGTGCCACAGGGGG - Intronic
1061262677 9:129488665-129488687 GATGACTCAGGGCCCCGAGACGG - Intergenic
1061534900 9:131241527-131241549 TGTGAGCCAGGCGCCCCAGGTGG - Intergenic
1062050177 9:134443097-134443119 GAAGTCTCAGGGGCCTCAGGAGG + Intergenic
1185614658 X:1413490-1413512 CCTGATTCAGGCGCCCCAGGAGG + Intronic
1189706444 X:43763539-43763561 GATGGCTTAGGCACCACAGGAGG + Intergenic
1197520376 X:127490047-127490069 CAGGACTCAGGGACCCCAGGAGG + Intergenic
1197805178 X:130392030-130392052 GAAGACTCAGATGCCCCAGAAGG - Intergenic
1198341079 X:135713849-135713871 GCTGACACAGGCGCCCATGGCGG - Intronic
1198346849 X:135767773-135767795 GCTGACACAGGCGCCCATGGCGG + Intronic
1198348756 X:135785057-135785079 GCTGACACAGGCGCCCATGGCGG + Intergenic
1198350661 X:135802331-135802353 GCTGACACAGGCGCCCATGGCGG + Intronic
1198352568 X:135819594-135819616 GCTGACACAGGCGCCCATGGCGG + Intronic
1198354477 X:135836862-135836884 GCTGACACAGGCGCCCATGGCGG + Intronic
1198356387 X:135854120-135854142 GCTGACACAGGCGCCCATGGCGG + Intronic
1198358300 X:135871394-135871416 GCTGACACAGGCGCCCATGGCGG + Intergenic
1198360214 X:135888668-135888690 GCTGACACAGGCGCCCATGGCGG + Intronic