ID: 998261494

View in Genome Browser
Species Human (GRCh38)
Location 5:140635161-140635183
Sequence GGCTCATCACTGCCCCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998261490_998261494 -6 Left 998261490 5:140635144-140635166 CCCAATCCAAACAAGAAGGCTCA No data
Right 998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG No data
998261491_998261494 -7 Left 998261491 5:140635145-140635167 CCAATCCAAACAAGAAGGCTCAT No data
Right 998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG No data
998261489_998261494 -5 Left 998261489 5:140635143-140635165 CCCCAATCCAAACAAGAAGGCTC No data
Right 998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998261494 Original CRISPR GGCTCATCACTGCCCCCTGC GGG Intergenic
No off target data available for this crispr