ID: 998261766

View in Genome Browser
Species Human (GRCh38)
Location 5:140637141-140637163
Sequence CACCCTACTCCCACTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998261766_998261772 -5 Left 998261766 5:140637141-140637163 CCCCCAAGAGTGGGAGTAGGGTG No data
Right 998261772 5:140637159-140637181 GGGTGGAGGAGAAAAAGAACAGG No data
998261766_998261774 15 Left 998261766 5:140637141-140637163 CCCCCAAGAGTGGGAGTAGGGTG No data
Right 998261774 5:140637179-140637201 AGGGCTTGTTGACAAAGAGAAGG No data
998261766_998261773 -4 Left 998261766 5:140637141-140637163 CCCCCAAGAGTGGGAGTAGGGTG No data
Right 998261773 5:140637160-140637182 GGTGGAGGAGAAAAAGAACAGGG No data
998261766_998261775 27 Left 998261766 5:140637141-140637163 CCCCCAAGAGTGGGAGTAGGGTG No data
Right 998261775 5:140637191-140637213 CAAAGAGAAGGTCCCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998261766 Original CRISPR CACCCTACTCCCACTCTTGG GGG (reversed) Intergenic
No off target data available for this crispr