ID: 998266734

View in Genome Browser
Species Human (GRCh38)
Location 5:140672618-140672640
Sequence AAGTGTGAGCTGAGCGTTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998266734_998266737 4 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266737 5:140672645-140672667 GTGCTGCGGCACACGAGCAGCGG 0: 2
1: 0
2: 1
3: 3
4: 87
998266734_998266742 26 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266742 5:140672667-140672689 GGCAGGACGGCCGCAGCGGATGG 0: 1
1: 2
2: 0
3: 19
4: 144
998266734_998266740 13 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266740 5:140672654-140672676 CACACGAGCAGCGGGCAGGACGG 0: 2
1: 0
2: 1
3: 7
4: 172
998266734_998266738 5 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266738 5:140672646-140672668 TGCTGCGGCACACGAGCAGCGGG 0: 2
1: 0
2: 1
3: 4
4: 85
998266734_998266736 -10 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266736 5:140672631-140672653 GCTCACACTTCTCGGTGCTGCGG 0: 1
1: 2
2: 1
3: 8
4: 135
998266734_998266739 9 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266739 5:140672650-140672672 GCGGCACACGAGCAGCGGGCAGG 0: 2
1: 0
2: 1
3: 4
4: 93
998266734_998266741 22 Left 998266734 5:140672618-140672640 CCGTCAACGCTCAGCTCACACTT 0: 1
1: 0
2: 2
3: 27
4: 244
Right 998266741 5:140672663-140672685 AGCGGGCAGGACGGCCGCAGCGG 0: 3
1: 0
2: 2
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998266734 Original CRISPR AAGTGTGAGCTGAGCGTTGA CGG (reversed) Exonic
900323274 1:2095384-2095406 ACGTGAGAGCTGAGCATTGGTGG + Intronic
900723717 1:4200124-4200146 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
902168638 1:14593005-14593027 AAGTATGTGCTGAGCACTGAAGG + Intergenic
902305710 1:15537263-15537285 TATTGTGAGCTGAGCCTTGAAGG + Intronic
904905214 1:33892529-33892551 AAGTGGGAGCTAAGCTATGAGGG - Intronic
905325992 1:37152320-37152342 ATGTATTAGCTGAGAGTTGAAGG - Intergenic
905400147 1:37695642-37695664 ATGTTTGAGCTGAGTTTTGAAGG + Intronic
905983115 1:42249924-42249946 AAATGTGAGCTGGGCTTTAAAGG + Intronic
906070770 1:43014876-43014898 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
906508824 1:46399500-46399522 AAATGTGTGCTGAGCGTGGAGGG + Intronic
907514486 1:54984798-54984820 GAGGCTGAGCTGAGCCTTGAGGG + Intronic
908255547 1:62300503-62300525 ATTTTTGAGCTGGGCGTTGAAGG + Intronic
908360688 1:63366465-63366487 AGGAGTCAGCTGAGCTTTGAAGG - Intergenic
910064115 1:83132373-83132395 AAGTGTGCAATTAGCGTTGACGG - Intergenic
910233637 1:85012030-85012052 AAGTGGGAGCTAAGCTATGAGGG + Intronic
910602000 1:89042636-89042658 AAGAGTGAGCTGAGTGGGGAGGG + Intergenic
911559228 1:99383611-99383633 AAGTGTGAGCTAAATATTGAAGG + Intergenic
912972692 1:114298922-114298944 AAGCTTGGGCTGAGTGTTGAAGG - Intergenic
913590547 1:120320551-120320573 AAATCTGAGCTGAGCTTTGAAGG + Intergenic
913617637 1:120577812-120577834 AAATCTGAGCTGAGCTTTGAAGG - Intergenic
914572634 1:148933160-148933182 AAATCTGAGCTGAGCTTTGAAGG + Intronic
914600206 1:149197102-149197124 AAATCTGAGCTGAGCTTTGAAGG - Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916396477 1:164394383-164394405 AAGTGAGAGCTAAGCTATGAGGG + Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
918039872 1:180907549-180907571 ACATGTGAGCTGAGTGTGGAAGG + Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
919324686 1:196091733-196091755 GAATGTGAGATGAGCCTTGAAGG + Intergenic
919955396 1:202409604-202409626 AAGTGTTGGCTGGGCGTTGTGGG - Intronic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
923394256 1:233544869-233544891 AAGTGTGAGCTGAGTGTGAGAGG - Intergenic
923478401 1:234359018-234359040 AATTGTGATCTGAACGTTGGAGG - Intergenic
923544589 1:234914871-234914893 ACGTGTGAGCTGAGACTTGAAGG + Intergenic
924685488 1:246285172-246285194 AAGTGAGAGCTAAGCTATGAGGG - Intronic
924895623 1:248335585-248335607 AAGTGGGAACTGAGCTATGAGGG - Intergenic
1064158001 10:12919706-12919728 AAGTCTGTGCTGAGCATGGAAGG - Intronic
1067233659 10:44428561-44428583 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1068726238 10:60306264-60306286 AAGTGAGAGCTAAGCTATGATGG - Intronic
1070020139 10:72577116-72577138 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1070330206 10:75410859-75410881 ATGTGTGAGCTGAGACCTGAAGG - Intergenic
1070460830 10:76668189-76668211 AAGAGAGTGCTGAGAGTTGAGGG + Intergenic
1071250306 10:83811560-83811582 ATGTGTGAGCTGAGCTGTGCAGG - Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1075000135 10:118790866-118790888 AAGTGAGAGCTTAGCTATGAGGG + Intergenic
1075147610 10:119895648-119895670 ATGCTTGAGCTGAGTGTTGAAGG + Intronic
1075494275 10:122906291-122906313 AAGTGGGAGCTAAGCCATGAGGG + Intergenic
1076172693 10:128335559-128335581 AAATGTTAGCTGAGCGTTTGTGG - Intergenic
1076462025 10:130654338-130654360 AGGTGTGAGCTGAGGGCTGGGGG + Intergenic
1076947449 10:133660832-133660854 AATGGTGACCTGAGAGTTGAGGG - Intergenic
1077976987 11:7257177-7257199 AAATGTGAGCTGAGCTGAGAAGG - Intronic
1077994558 11:7442180-7442202 CACTGAGAGCAGAGCGTTGATGG - Intronic
1078458483 11:11494467-11494489 GAGTTTGAGCTGAGCTTTGCAGG - Intronic
1078622102 11:12917735-12917757 AAGTTTCAGCTTAGCGTTTAGGG + Intronic
1079180839 11:18192183-18192205 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1079395046 11:20055016-20055038 GAGTAGGAGCTGAGCCTTGAAGG + Intronic
1079405374 11:20140593-20140615 AAGTAGGAGCTGTGTGTTGAGGG + Intergenic
1079482520 11:20896192-20896214 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1081974079 11:47220174-47220196 AAGTGTGAGATGGGTGTTCAAGG + Intronic
1083611341 11:64005849-64005871 AGGTGTGAGCTGGGGTTTGAGGG + Intronic
1084036316 11:66513193-66513215 ATGTGTGAACTGGGCATTGAAGG + Intronic
1089312017 11:117564610-117564632 AGGTTTGAGCAGAGCCTTGAGGG - Intronic
1091225677 11:133955665-133955687 AAGTGGGAGCGGAGCCTGGAGGG - Intronic
1092158229 12:6298954-6298976 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1094266659 12:28567332-28567354 AAGTTTCAGCTGAGCTTTAAGGG + Intronic
1095561947 12:43575703-43575725 ATATTTGAGCTGAGCTTTGAAGG - Intergenic
1096251175 12:50033400-50033422 ACCTCTGAGCTGAGCTTTGAAGG + Intergenic
1096560815 12:52434467-52434489 GAGTGTGAGCTCAGGGTTGGCGG - Exonic
1097311566 12:58124542-58124564 AAGTGGGAGCTGAACAATGAGGG - Intergenic
1100059652 12:90558682-90558704 AAGTGTGAGCTAAACAATGAAGG - Intergenic
1100800470 12:98225317-98225339 AACTGTTACCTGAGGGTTGATGG + Intergenic
1101118323 12:101553542-101553564 AAATGAGAGCTGATCTTTGAGGG + Intergenic
1105577014 13:21662993-21663015 TACTGTGAGCAGAGCATTGAGGG - Intergenic
1108016891 13:46085925-46085947 AAGGGCGAGCTGAGCGGTGAGGG + Intronic
1108274491 13:48793734-48793756 AGGTTTGAGCTCAGCATTGAAGG + Intergenic
1109185912 13:59268029-59268051 AAGAATGAGCTGAACTTTGATGG - Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1111473520 13:88717846-88717868 AGGCTTGAGCGGAGCGTTGATGG - Intergenic
1111648845 13:91064718-91064740 AAGTGTGGTCTGAGGGTTCAGGG + Intergenic
1114450589 14:22822613-22822635 AAGAGGAAGCTGAGCGTTCATGG - Intronic
1114867699 14:26617699-26617721 AAGTGGGAGCTAAACATTGAAGG + Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1116593948 14:46815834-46815856 AAGTCTGAGCAGAGACTTGAAGG - Intergenic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117726779 14:58682583-58682605 ATGTTTGAGCTGAACTTTGAAGG + Intergenic
1120544583 14:85795135-85795157 AAATTTAAGCTGGGCGTTGAAGG + Intergenic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1122418148 14:101560211-101560233 AAATGGGTGCTGAGCGTTTAGGG - Intergenic
1124889082 15:33715150-33715172 AAGTGTCATCTTAGCTTTGAAGG + Intronic
1125672586 15:41484807-41484829 AAATTTGAGCTGGGAGTTGATGG - Intergenic
1126988213 15:54339475-54339497 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1129115815 15:73364799-73364821 AAGGGTGGGCTGTGCTTTGAGGG - Intronic
1131064034 15:89421861-89421883 AAGTGTGATGTGAGCACTGATGG + Intergenic
1133416813 16:5613253-5613275 ATGTGTGTTCTGAGCCTTGAAGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1135223182 16:20631798-20631820 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1135868127 16:26123724-26123746 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1137400436 16:48148826-48148848 ATGTTTGAACTGAGCCTTGAAGG - Intronic
1137615090 16:49841655-49841677 AAGTGTGGGCTGAGGGCTGTGGG - Intronic
1139239755 16:65378692-65378714 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1140721690 16:77777840-77777862 AAATGTGAGCTCAGGGTTGCTGG - Intergenic
1141012321 16:80414338-80414360 AACTCTGAGCTGAACCTTGAAGG - Intergenic
1141187012 16:81795326-81795348 ATGTTTGAGCTGAGACTTGAAGG + Intronic
1146230287 17:31101690-31101712 AAATCTGAGCTGAACATTGAAGG - Intronic
1147286622 17:39407530-39407552 AAGTCTGGGCTGAGCCTTGAGGG + Exonic
1147418414 17:40309773-40309795 AAGTGTGAGATGAACCTGGAAGG - Intronic
1148065941 17:44869823-44869845 TAGTGTGAGCTGAGTGCTGTAGG - Intronic
1148148977 17:45384971-45384993 GAGAGTGAGCTGAGCTCTGAAGG + Intergenic
1148150013 17:45391398-45391420 AGGTGTGAGCTGAGGCTTGGGGG + Intergenic
1148534584 17:48429344-48429366 CAGTGTGTGTTGAGTGTTGACGG + Intronic
1148554656 17:48571246-48571268 CAGCGTGAGTTGAGCGCTGACGG - Intronic
1148653281 17:49264995-49265017 ATGTGTGAGCTGGGTTTTGAAGG + Intergenic
1150219169 17:63486466-63486488 AAGTGGGAGCTGAGGGCTGGAGG - Intronic
1150893760 17:69185082-69185104 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1150944950 17:69734867-69734889 AAGCATGAGCTGAGATTTGAAGG - Intergenic
1151092435 17:71458115-71458137 AAGTGAGGGCTGAGGGTTGGGGG - Intergenic
1151653242 17:75483049-75483071 ATGTTTGAGCTGAGTCTTGAAGG + Intronic
1154249176 18:12728782-12728804 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1154436539 18:14347151-14347173 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1158507060 18:58056274-58056296 AAGTGACAGCTGACAGTTGATGG + Intronic
1159850731 18:73524338-73524360 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1160497311 18:79383146-79383168 AGCTGAGAGCTGAGCGATGACGG - Intergenic
1161638844 19:5406945-5406967 ATGTGTGAGCTGAGGCTTGAAGG - Intergenic
1166137532 19:40786459-40786481 CTGTGTGAGCTGAGCTCTGAAGG + Intronic
1167167838 19:47811408-47811430 TAGTGTGAGCAGAGCCTTGTGGG + Intronic
1167780533 19:51595935-51595957 AAGTTTGAGCTGAGACTTGAAGG + Intergenic
926582069 2:14641693-14641715 AAGTATAAGCTGAGAGTTGAAGG - Intronic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
928714148 2:34040976-34040998 AAGTCTCAGATGAGCCTTGATGG + Intergenic
930573854 2:53121918-53121940 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
934489451 2:94750353-94750375 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
938072308 2:128315182-128315204 AAGAGTGAGCAGAGCATTGGCGG - Intronic
938489954 2:131756157-131756179 AAGTTTCAGCTGAGGTTTGAGGG + Intronic
938700109 2:133869883-133869905 AAGTGTGAGCTAAGCTGTGAGGG + Intergenic
939868620 2:147503259-147503281 AAGTATAAGCTGGGCCTTGAGGG + Intergenic
940125808 2:150322748-150322770 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
941107577 2:161375499-161375521 AAGCTTGGGCTGAGCTTTGAGGG + Intronic
941154602 2:161960450-161960472 AAGTGTGAGCTGACCGTGCCTGG - Intronic
941844057 2:170116094-170116116 AAGTGTGAGATAAGAATTGAAGG - Intergenic
944430105 2:199623984-199624006 AAATATCAGCTGAGCATTGATGG + Intergenic
944443886 2:199769963-199769985 AAATGTGAGCTGAGCTTTAGAGG - Intronic
944908916 2:204290238-204290260 ATGTTTGAGCTGAGAGTTGAAGG + Intergenic
946749978 2:222884459-222884481 AAGTATCAGCAGAGCTTTGAAGG + Intronic
948305168 2:236941047-236941069 AAATCTGAGCTGAGCCTTAATGG - Intergenic
1169285288 20:4302395-4302417 AAATCTGAGCTGAGTGTGGAAGG + Intergenic
1170763439 20:19271769-19271791 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1173130263 20:40386328-40386350 AACTCAGAGCTGAGCATTGAAGG - Intergenic
1173255303 20:41390381-41390403 ATATTTGAGCTGAGCCTTGAAGG - Intergenic
1173326441 20:42037828-42037850 AAGGTTGAGATGAGCGTTTATGG + Intergenic
1175249010 20:57597731-57597753 TGGGGTGCGCTGAGCGTTGAAGG + Intergenic
1176706704 21:10123540-10123562 AAGTTTCAGCTGAGGTTTGAGGG + Intergenic
1176728594 21:10466056-10466078 AAGTGGGACCTGAGGGCTGAAGG + Intergenic
1176840505 21:13838501-13838523 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1178363083 21:31966117-31966139 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1179268797 21:39831800-39831822 ATGTGTAATCTGAGCCTTGAGGG + Intergenic
1179481018 21:41678745-41678767 AACTGGGAGCTGAGCACTGATGG + Intergenic
1181100962 22:20538602-20538624 AAGTGGTAGCTGAGGGTTGAAGG - Intronic
1181695225 22:24589613-24589635 AAGTGTGAGCTGTGCTTTGCAGG - Intronic
1181891544 22:26067816-26067838 ACATTTGAGCTGAGAGTTGAAGG - Intergenic
1183037575 22:35151700-35151722 AAGTTTGTGCTAAGCTTTGAAGG + Intergenic
1184094607 22:42309690-42309712 AAGTCTGAGCTGAGACTGGAAGG - Intronic
951407069 3:22314330-22314352 AAGTGGGAGCTAAGCTATGAGGG - Intronic
953863284 3:46563460-46563482 CAGTGTGTGCTGAGCTCTGAGGG - Intronic
955372611 3:58366597-58366619 AAGTTTGAGCTGGGCTGTGAAGG - Intronic
955631206 3:60977538-60977560 AAGTGTGTGCTGAGCAGTGGGGG + Intronic
958152569 3:89709605-89709627 AAGTGGGAGCTAAGCTATGAAGG + Intergenic
958906845 3:99951189-99951211 AAGTATCAGCTGAGGGCTGAAGG - Intronic
959347637 3:105219218-105219240 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
960031224 3:113056801-113056823 ACATTTGAGCTGAGTGTTGAAGG - Intergenic
960342212 3:116487260-116487282 AGGTGGGTGCTGTGCGTTGAGGG - Intronic
963461549 3:145620094-145620116 AAGTCTGAGTTGAGCGTTTTAGG + Intergenic
963688062 3:148463200-148463222 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
964325438 3:155541168-155541190 AAGTGGGAGCTAAGCTATGAGGG + Intronic
964955651 3:162352842-162352864 AAGCGTGAGCTGAGAGTTCAAGG - Intergenic
965130793 3:164697464-164697486 AAGTGTGAGCTAAGCTATGTGGG - Intergenic
966153881 3:176894962-176894984 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
967041937 3:185701991-185702013 ATGTGTGAGCTGCGTTTTGAAGG - Intronic
967139313 3:186540784-186540806 ATCTTTGAGCTGAGCATTGAAGG + Intronic
967399480 3:189044567-189044589 AAAAGTGAGCTGAGCTTTGAAGG + Intronic
968911801 4:3480146-3480168 ACGTTTGAGCTGGGCCTTGAGGG + Intronic
969269998 4:6093135-6093157 AGGTGTGAGCTGGGTTTTGAAGG - Intronic
969676375 4:8616576-8616598 GAGTGTGAGCTGTGTTTTGAAGG + Intronic
970541197 4:17081596-17081618 ATGTGTGAGCTGAGCCTTGAAGG - Intergenic
973998147 4:56480859-56480881 AAGTTTGAGCTGACCCTTGAAGG + Intronic
974025153 4:56727116-56727138 ATGTGTGAGCTGAGTCTTGAAGG + Intergenic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975586844 4:75958698-75958720 AAGTGTGAGCAAAGTCTTGAAGG - Intronic
975633857 4:76426426-76426448 AGGTGTGAGCAGAACCTTGAAGG + Intergenic
975928317 4:79487004-79487026 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
976771453 4:88657741-88657763 AAGTTTGAGCTGTGCCTCGAAGG + Intronic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
978019849 4:103794016-103794038 AAGTGGGAGCTAAGCTGTGAGGG + Intergenic
979881699 4:125967767-125967789 AAATGTGAGCTGAACTTTAAAGG - Intergenic
981684963 4:147443663-147443685 AAGTTTGATCTGAGTCTTGAAGG + Intergenic
982134423 4:152259595-152259617 AATTTTGAGCTGAGAGCTGAGGG - Intergenic
982201299 4:152963563-152963585 AATTGTTTGGTGAGCGTTGAGGG + Intronic
985363700 4:189203347-189203369 ACATGTGAGCTGAGAGCTGATGG - Intergenic
985450904 4:190061632-190061654 AATGGTGACCTGAGAGTTGAGGG - Intergenic
986192339 5:5509207-5509229 CACTGTGAGCTGAGCAGTGACGG + Intergenic
986420242 5:7573354-7573376 AAGTGTGAGCGAAGGATTGAAGG + Intronic
986706121 5:10456006-10456028 AGGTGTGAGGTGACTGTTGAGGG + Intronic
988461027 5:31438025-31438047 AAGTGTGATCTGTGCACTGAGGG - Intronic
990918219 5:60933783-60933805 AAGTGGGAGCTGAGCTATGGAGG - Intronic
991240708 5:64456998-64457020 ATGTTTAAGCTGAGGGTTGACGG - Intergenic
994209698 5:97073863-97073885 AAGTGTGAGCTGTGCCCTGGGGG + Intergenic
995732499 5:115261328-115261350 TAATGTGAGCTGAGCCCTGAAGG - Intronic
997753753 5:136375030-136375052 AAGTGGAAGCTGAGGGTTAATGG + Intronic
998131288 5:139652371-139652393 AAGGGTGGGCTCAGCGTTGGGGG - Intronic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
998919518 5:147052540-147052562 GAGCTTGAGCTGAGAGTTGAAGG + Intronic
1000013792 5:157259115-157259137 AAGTTTGAGATGTGCATTGAAGG + Intergenic
1001192518 5:169643916-169643938 CAGTGTCAGCTGAACCTTGAGGG + Intronic
1002319771 5:178368056-178368078 GTGTGTGAGCAGAGCCTTGAAGG + Intronic
1003375692 6:5575011-5575033 AAGGGTGAGCTGTGTGTTGTTGG + Intronic
1004296357 6:14415484-14415506 AAGTCTGAGCTGAGCTTTGAAGG - Intergenic
1004611980 6:17250765-17250787 AAGAGTGGGGTGAGGGTTGAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1013279951 6:108626851-108626873 GTATGTGAGCTGAGCCTTGAAGG + Intronic
1016669389 6:146684352-146684374 AGGTGTCAGCTGAGAGTTGAAGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1022873110 7:34500160-34500182 AAGTGGGAGCTGGGATTTGAAGG + Intergenic
1023336919 7:39180084-39180106 AATTCTGAGCTGAGGTTTGAAGG + Intronic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1028533321 7:91863103-91863125 AAATGTAAGCTGAGACTTGAAGG - Intronic
1028596634 7:92553113-92553135 GACTGTGAACTGAGCCTTGAAGG + Intergenic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1031140575 7:117938352-117938374 ACTTTTGAGCTGAGCCTTGAGGG + Intergenic
1032171826 7:129591229-129591251 AACTGTCAGATGGGCGTTGAAGG - Intergenic
1033462526 7:141560672-141560694 AAGTGAGAGCTAAGCTATGAGGG - Intronic
1034301738 7:150021677-150021699 AAGTGGGAGCTCAGCTATGAGGG - Intergenic
1034564255 7:151900719-151900741 AAGCTTGAGCTGAGCCTTGAAGG + Intergenic
1034804308 7:154075590-154075612 AAGTGGGAGCTCAGCTATGAGGG + Intronic
1036499949 8:9304615-9304637 ACATGTGGGCTGTGCGTTGAAGG + Intergenic
1037362266 8:18085649-18085671 AAGTTTGAGCAGACAGTTGAGGG + Intergenic
1037625910 8:20606838-20606860 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1038058482 8:23885359-23885381 AAATGGGAGCTAAGCTTTGAGGG - Intergenic
1038355580 8:26826092-26826114 CACTTTGAGCTGAGCTTTGAGGG - Intronic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039397761 8:37241684-37241706 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1040395523 8:46996528-46996550 ACTTGTGAGCTGAGAGGTGATGG + Intergenic
1041430248 8:57773415-57773437 AAGTGGGAGCTAAACATTGAGGG + Intergenic
1043144464 8:76635146-76635168 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1044299238 8:90564663-90564685 ATGTGTGATCTGAACGTGGAGGG + Intergenic
1046042251 8:108919920-108919942 AAGTTTGAGCTGGGCAATGAAGG - Intergenic
1050167131 9:2777042-2777064 AAGTGGGAGCTGAACAATGAGGG + Intronic
1050409160 9:5343666-5343688 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1053168678 9:35862702-35862724 GTGTGTGAACTGAGCCTTGAAGG - Intergenic
1053361144 9:37487358-37487380 ATGTTGGAGCTGAGCCTTGAAGG + Intronic
1054324855 9:63707889-63707911 AAGTTTCAGCTGAGGTTTGAGGG + Intergenic
1055449657 9:76419381-76419403 AAGTGTAAGCTGGGCGTAGTGGG + Intergenic
1055690065 9:78820526-78820548 CAGTGTGAGCTCAGCTCTGATGG + Intergenic
1055966007 9:81865903-81865925 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1057968619 9:99530522-99530544 CAGTCTGAGCTGGGCCTTGATGG - Intergenic
1059337535 9:113578657-113578679 AAGTGTTAGCTGAGCCATCAAGG + Intronic
1059438904 9:114291792-114291814 GAGTGTGAGCTGAGGTTTGAAGG + Intronic
1060089074 9:120727304-120727326 GAGTTTGAGCTAAGCCTTGAAGG + Intergenic
1060425322 9:123499737-123499759 ATGCCTGAGCTGAGCCTTGAAGG - Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1062673495 9:137725383-137725405 ATGTCTGAGCTGTGCTTTGAAGG + Intronic
1185867285 X:3635207-3635229 AACTTTGAGCTGTGTGTTGAAGG + Intronic
1186785069 X:12949502-12949524 AAATTTGAGCTGAGATTTGAGGG - Intergenic
1189051058 X:37646008-37646030 GAATATGAGCTGAGCTTTGAAGG - Intronic
1189225180 X:39406837-39406859 AAGCTTGAGCTGAGGCTTGATGG - Intergenic
1192487498 X:71541975-71541997 AAGTTTAAGCTGGGCCTTGAAGG - Intronic
1192879867 X:75272515-75272537 AAGTGGGAGCTTAGCTATGATGG + Intergenic
1192904358 X:75534549-75534571 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1192944605 X:75951638-75951660 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1193595967 X:83445650-83445672 AACTGAGAGCTAAGCTTTGAGGG - Intergenic
1196808858 X:119612657-119612679 AAGTAGGACCTGAGCCTTGAAGG + Intergenic
1198767987 X:140097579-140097601 AAGCCTGAGGTGAGCTTTGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199358260 X:146886291-146886313 AAGTGTGAGCTGTGCCGTGTGGG - Intergenic