ID: 998267676

View in Genome Browser
Species Human (GRCh38)
Location 5:140678291-140678313
Sequence TTCTGGATGAATAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998267676_998267681 -5 Left 998267676 5:140678291-140678313 CCATTTTCCCTATTCATCCAGAA 0: 1
1: 0
2: 1
3: 36
4: 307
Right 998267681 5:140678309-140678331 CAGAAGCCCTGGCATCAGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998267676 Original CRISPR TTCTGGATGAATAGGGAAAA TGG (reversed) Intronic
902729169 1:18357361-18357383 ATATGGATGAATTGGGGAAAGGG + Intronic
905098536 1:35497162-35497184 TTTTGGATAAATGGGGACAAGGG + Intronic
905227066 1:36485965-36485987 TACAGGATGAATGGGGAGAAGGG - Intergenic
905374379 1:37509148-37509170 TCCAGGAAGAAGAGGGAAAAGGG + Intronic
905384858 1:37595608-37595630 TTGGGGATGAAAAGGGAAAAAGG - Intronic
909212239 1:72838634-72838656 TTCAGGATGTACAGGGAACATGG - Intergenic
910342194 1:86200888-86200910 TTCTGGTTTCATAGGGATAATGG + Intergenic
911299936 1:96159616-96159638 TTCTGGTTAAAAAGGGAAAGGGG + Intergenic
911722567 1:101207358-101207380 TTCTGAATGTATTGAGAAAAAGG - Intergenic
912400332 1:109385899-109385921 TTATGGACCAATAGAGAAAATGG - Intronic
912954882 1:114148394-114148416 TTTGGGGTGAGTAGGGAAAATGG - Intronic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
913386608 1:118264573-118264595 TTCTGGATGACTGGGAAATAGGG - Intergenic
914260819 1:145997529-145997551 TTCTGGAGGAAAAGGAAAAGCGG + Intergenic
914505544 1:148286148-148286170 TTCTGAGGGAACAGGGAAAAGGG - Intergenic
915503242 1:156334975-156334997 TGTTGGAGTAATAGGGAAAAGGG + Intronic
916032104 1:160885859-160885881 TTCTGAATAAATTGGTAAAAAGG + Intergenic
916068705 1:161157207-161157229 TACTGGAAGAATAGGCAAATTGG + Intronic
916230711 1:162538615-162538637 AGCTGTATGAATAGGTAAAAGGG + Intergenic
917409425 1:174742571-174742593 TTCTGGATGGATTGGGTTAATGG + Intronic
918444229 1:184600547-184600569 TTCTGGATGCAAAAGCAAAAGGG - Intronic
919210960 1:194485454-194485476 TTCTCAATGAAAAGGAAAAATGG - Intergenic
920359058 1:205399817-205399839 TATTGAATGAATAGGGAGAAAGG + Intronic
920708275 1:208271226-208271248 TTCTGGCTGAATGGAGAAACGGG + Intergenic
921920351 1:220661791-220661813 TTCTGGAACAAGAGGGCAAAGGG - Exonic
922906784 1:229179445-229179467 TTTTGGATGAATTGAGAAACTGG - Intergenic
923714912 1:236416599-236416621 TTCAGCATGAATAAGGACAAAGG - Intronic
923914402 1:238485926-238485948 TTTTGGGTGAAAAGGAAAAATGG + Intergenic
924506961 1:244695219-244695241 TTTTGGAAGGGTAGGGAAAAGGG - Intronic
924829705 1:247580029-247580051 CTCTGGATCAAAAGGTAAAAAGG + Intergenic
1064560019 10:16586581-16586603 TTCTGGATGAGACGGGGAAAGGG + Intergenic
1064977338 10:21132135-21132157 TTCTTGGAGAATAGGGATAATGG - Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1067659185 10:48221804-48221826 TTCTGGATGAATAGGTGGATGGG + Intronic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1068184639 10:53569209-53569231 TTCTAGACATATAGGGAAAAAGG + Intergenic
1069113768 10:64478548-64478570 GGATGGATGTATAGGGAAAAGGG - Intergenic
1069389777 10:67921397-67921419 AAGTGGATGAACAGGGAAAATGG + Intergenic
1070793734 10:79204853-79204875 TTCTGGATGAATGGGTAGATAGG + Intronic
1071193636 10:83131403-83131425 TTCTGGAAGAAGAAAGAAAAAGG + Intergenic
1071306806 10:84306562-84306584 TGCTGGATGAAGTGGGAAATGGG - Intergenic
1072477062 10:95772485-95772507 TTATGGATGAACAGAGAAAGTGG - Intronic
1072830074 10:98648188-98648210 CTCTGGATATATGGGGAAAAGGG - Intronic
1076646867 10:131959856-131959878 TTCTAGAGGAAGATGGAAAAGGG - Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1078870006 11:15334614-15334636 TTCTGGATGAAGAAAAAAAATGG + Intergenic
1079154722 11:17935089-17935111 TTCTGGTTGAATTGGGAATAGGG - Intronic
1079324655 11:19481202-19481224 TACTGGATGGATAGGGACAATGG + Intronic
1079568604 11:21914924-21914946 TTGTGTATGCATTGGGAAAAGGG + Intergenic
1079871069 11:25798582-25798604 TTCAGGATGAATAGGCAAGCTGG + Intergenic
1079884074 11:25964180-25964202 TACTGGGTGAAAAGGAAAAAAGG - Intergenic
1080127069 11:28747839-28747861 TTCTGGATAAATAGCCAACAGGG - Intergenic
1080194159 11:29588395-29588417 TGCTAGATGAATAGTGCAAAGGG - Intergenic
1080456379 11:32423248-32423270 GTCTGGATGGACAGGGAGAAAGG + Intronic
1080711717 11:34754448-34754470 TTCTGGATCAATCCTGAAAATGG - Intergenic
1080996638 11:37610357-37610379 TTCTGGAGTAATGGTGAAAAAGG + Intergenic
1081919771 11:46762836-46762858 TTTTGAAAGAATAGGGAAATAGG + Intronic
1082278433 11:50246060-50246082 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1084395125 11:68904345-68904367 TACTGAATGAATAAGGGAAAGGG - Intronic
1084456725 11:69272100-69272122 GGCTGGATGAATAGGTAAATCGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1086165641 11:83774797-83774819 TGCTGGAAGATTAGTGAAAATGG - Intronic
1087589545 11:100169085-100169107 TTATGGATGAATAAAGAAAGTGG + Intronic
1087675159 11:101153186-101153208 TTGTGGAAGAATAGAGAAGAAGG - Intergenic
1089234288 11:117010038-117010060 TTCTGGCTGCATGGAGAAAAGGG + Intronic
1089275901 11:117336038-117336060 CCCTGAATGGATAGGGAAAATGG - Intronic
1090368784 11:126230994-126231016 TGGTGGATGAAAAAGGAAAAAGG - Intronic
1090984805 11:131756752-131756774 TTCAAGATGAAGAGAGAAAACGG + Intronic
1091068302 11:132538886-132538908 ATATGGATGAATGGGGAATATGG - Intronic
1091769930 12:3144905-3144927 GTCTGGGGGAATAGGGAAAAGGG - Intronic
1093873643 12:24322925-24322947 TTGTGTTTGAATTGGGAAAAAGG - Intergenic
1094108706 12:26838938-26838960 ATCTGTCTGAGTAGGGAAAAAGG - Intergenic
1094759692 12:33516670-33516692 TCAGGGAAGAATAGGGAAAATGG + Intergenic
1095550647 12:43434896-43434918 TTCTGGAGGCAGAGGGAAAAAGG - Intronic
1095880425 12:47130006-47130028 CTCTAGATGAAAAGGGAACAAGG - Intronic
1096756216 12:53802218-53802240 CTCTGGATGAAAAGTAAAAAGGG - Intergenic
1097844687 12:64354172-64354194 TTCTGGATAAAAAAGGGAAAAGG + Intronic
1098083396 12:66813898-66813920 TTCTGGTTGTTTATGGAAAATGG + Intergenic
1098878903 12:75896273-75896295 TTCTGGGTGAATAGCTACAATGG + Intergenic
1099287082 12:80726620-80726642 ATCTGGATGAAAAGTAAAAAAGG - Intergenic
1099803881 12:87492909-87492931 TGCTGGATAAAGAGGGAAATAGG - Intergenic
1100334093 12:93613225-93613247 TTCTGTATAAATAGAAAAAAGGG + Intergenic
1100433907 12:94554367-94554389 TTCTGGAAGGAAAGGGAACAAGG - Intergenic
1102653089 12:114457149-114457171 TTCTAGAAGAATATGGAAATGGG + Intergenic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1106500687 13:30325585-30325607 TTCTGGATGGATAGCCAAAAAGG + Intergenic
1107350499 13:39509382-39509404 TTCTAGAAGAAAAGAGAAAAAGG - Intronic
1108391821 13:49954464-49954486 TTCTGGTTGATCTGGGAAAAGGG - Intergenic
1109590648 13:64476369-64476391 TTCTGAAGGAACAGGGCAAAGGG - Intergenic
1109962185 13:69645198-69645220 CTCTGGATGGATAGGGAACATGG + Intergenic
1110150700 13:72249644-72249666 TTGTGGGTGAAATGGGAAAATGG - Intergenic
1110249365 13:73364492-73364514 TACTGGATGAATTGGATAAAAGG + Intergenic
1111107449 13:83666039-83666061 TGCTGGATGATTAGAGAAATAGG + Intergenic
1112872728 13:103994686-103994708 TTCAGTATGCATATGGAAAAAGG - Intergenic
1113150592 13:107259167-107259189 TTATGGAGGAAAAGGGGAAAAGG - Intronic
1113545806 13:111148621-111148643 TTCTGTATGAATTGGGAGAATGG - Intronic
1114140551 14:19905010-19905032 GGCTTGTTGAATAGGGAAAAGGG - Intergenic
1114220741 14:20694053-20694075 TTCTGGGTGCAGAGGGGAAATGG - Exonic
1114583439 14:23786545-23786567 TACTGGGTGTATTGGGAAAAGGG + Intergenic
1115542007 14:34429567-34429589 TTCTGGAAGAGGAGGGATAATGG - Intronic
1116709192 14:48343500-48343522 TTCTGGATAACTAAGGATAATGG - Intergenic
1117206765 14:53451461-53451483 TTCAGGGAGAAAAGGGAAAAAGG + Intergenic
1117395586 14:55306206-55306228 TTCATTATGATTAGGGAAAATGG + Intronic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1120387103 14:83860504-83860526 ATGTGGATTAATAGGGAAATAGG + Intergenic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1124468117 15:29958535-29958557 TACTGAATGGAAAGGGAAAAAGG - Intronic
1125870504 15:43096706-43096728 TTCTGGATGAGCAGAGAAAGTGG - Intronic
1127802355 15:62488138-62488160 TTTAGGATTAATAGAGAAAATGG + Intronic
1127875482 15:63107924-63107946 TTCTAAGTGAAAAGGGAAAAAGG + Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130442559 15:83969717-83969739 TACTGGGGGAATGGGGAAAATGG + Intronic
1131001952 15:88946098-88946120 TGGTGGATGAATAGGAGAAAAGG + Intergenic
1136024249 16:27459898-27459920 TTCTGGATGAGGAGGGACAAAGG - Intronic
1138382712 16:56614556-56614578 TTCTGGATCAACAGGCAAAGAGG - Intergenic
1139687768 16:68617633-68617655 TTCTGGGTGACTACAGAAAAGGG - Intergenic
1140183143 16:72740811-72740833 TTCTGAATAAAGAGGGGAAATGG - Intergenic
1140529738 16:75654511-75654533 TTCAAGATGGAAAGGGAAAATGG + Intronic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1143370726 17:6437336-6437358 GTCTGCATGCATAGGTAAAATGG + Intergenic
1143904086 17:10196129-10196151 GTCTGGATCCATGGGGAAAAGGG - Intronic
1144037751 17:11382662-11382684 TGTTGGATGAAGAGGGAAAAAGG - Intronic
1145933359 17:28701264-28701286 TTCTGGGTGAAGACGGAAGAGGG + Intronic
1148692420 17:49537900-49537922 TTCTGGATGAGCAAAGAAAATGG - Intergenic
1149100954 17:52906374-52906396 TGCTGGGTTAATAGAGAAAACGG - Intergenic
1150271597 17:63869520-63869542 TACTGGTGGAATAGGGAGAAAGG - Intergenic
1153205901 18:2700518-2700540 TTCTAGATCAAAAGGGCAAATGG - Exonic
1153362617 18:4214388-4214410 TGCTGAATGAATAGGAAAAATGG - Intronic
1154066565 18:11111976-11111998 TTCTGACTTAAGAGGGAAAATGG + Intronic
1154987347 18:21565386-21565408 TTCTAGAAGTCTAGGGAAAAGGG + Intronic
1155142864 18:23058732-23058754 TTGTGGAGGGGTAGGGAAAAAGG - Intergenic
1155804840 18:30156209-30156231 TTCTGGATGGAAAGGAAAAGTGG - Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156305536 18:35875066-35875088 TACTGGATGAATTGGGACTATGG - Intergenic
1157318463 18:46614855-46614877 GTTTCGAAGAATAGGGAAAAAGG - Intronic
1158254230 18:55527430-55527452 TTCTCAATGAATAGGAAATACGG + Intronic
1158475209 18:57773777-57773799 TTACGGATGAATAGGGAGCAGGG - Intronic
1159034203 18:63261558-63261580 TGTTGAATGAATAGGAAAAAGGG + Intronic
1159932005 18:74322377-74322399 TTAGGCATGAATAAGGAAAATGG - Intronic
1160941615 19:1622699-1622721 TTCTGGATTAAGGAGGAAAAAGG - Intronic
1164413467 19:28025155-28025177 TTATGGAAGAATAGGCAGAAGGG - Intergenic
1164769969 19:30801153-30801175 GTCTGGATGAAGATGGACAAGGG - Intergenic
1165649449 19:37472871-37472893 TTGAAGATGAATAGAGAAAAAGG + Intronic
1167973513 19:53204796-53204818 TTCTGAATGTTTAGGGAACATGG - Intergenic
925109952 2:1325270-1325292 TTCTGGAGAAATAAGGTAAAGGG + Intronic
925353162 2:3217079-3217101 TTGTGGATGAGGAGAGAAAAGGG + Intronic
925628194 2:5862886-5862908 TTCTAGTTGTCTAGGGAAAAAGG + Intergenic
925736168 2:6965693-6965715 TTCCAGGTGAATAAGGAAAAAGG + Intronic
926142283 2:10374885-10374907 CTCTGGGTGAATAAGGACAAGGG - Intronic
926534807 2:14098686-14098708 TTCTGTAGGAAAAGGGAGAATGG - Intergenic
926742105 2:16120479-16120501 ATCTAGATGTATAGTGAAAATGG - Intergenic
927823785 2:26292844-26292866 TACTGTATGGAAAGGGAAAAAGG + Intergenic
928591797 2:32824460-32824482 TTTTGAATGAATAGGCAGAAAGG - Intergenic
928747259 2:34430048-34430070 TTCTGGCTGATTATAGAAAAAGG + Intergenic
929242939 2:39670621-39670643 TACTGGATGAATAGGAAGACAGG + Intronic
929403414 2:41611998-41612020 TTCTGGATCCATTTGGAAAAGGG - Intergenic
929749509 2:44695415-44695437 TTCTGGAAGAATAGTGAGTAGGG - Intronic
930348464 2:50217870-50217892 TTCTGGATGAATGGCTAAATGGG - Intronic
931904044 2:66822804-66822826 ATCTGGATTAATAAGGGAAAAGG - Intergenic
932286574 2:70538689-70538711 TTCTGGATGAACAAAGAAAGTGG + Intronic
933437049 2:82261295-82261317 TTATGGAGGAGTAGGGGAAATGG - Intergenic
934778473 2:96953930-96953952 GCCTGGAGGAAAAGGGAAAAAGG + Intronic
937474590 2:122203867-122203889 TTCTGTAATAATAGGGAACAGGG + Intergenic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
937845574 2:126575172-126575194 GTGTGGATGAATGGGGTAAATGG - Intergenic
938802935 2:134779408-134779430 TTCTGCAGGCATATGGAAAATGG - Intergenic
939185828 2:138859716-138859738 TTATGGATGAAAAGAGAAAATGG - Intergenic
939272483 2:139958625-139958647 ATTTGGATGATTAGGGAATAGGG + Intergenic
939406842 2:141769591-141769613 TTCTGGATGGTTAGGGCAAATGG + Intronic
939846865 2:147257243-147257265 TTCTGATTACATAGGGAAAAGGG - Intergenic
940603842 2:155895058-155895080 TGCAGGAAGAGTAGGGAAAAAGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
943291585 2:186078913-186078935 TTCTTGATGATTTGGGAGAAGGG + Intergenic
943493026 2:188580710-188580732 TTCTGGAAGCAGAGAGAAAAAGG - Intronic
946541518 2:220689389-220689411 TTCTGGATTAACACAGAAAATGG - Intergenic
946705133 2:222450890-222450912 CTCTGGATGAATAGGGTAATGGG + Intronic
947022773 2:225700237-225700259 TTCTGAAAAAATAAGGAAAAAGG + Intergenic
947301358 2:228690961-228690983 TTCTGGATGAATAACTAAAGGGG + Intergenic
947427191 2:229994609-229994631 TTCAGGTTGAATAGGGAAGGTGG + Intronic
1168731521 20:86332-86354 TTCTGGGTGAAAATGGGAAAAGG - Intergenic
1169564870 20:6843031-6843053 TTCTGGAGGGAATGGGAAAAGGG - Intergenic
1170662707 20:18358593-18358615 TTCTTGGTGAATTGGGAACAGGG - Intergenic
1171426550 20:25052131-25052153 TTCAGGATGAAAAGGTAGAAAGG + Intronic
1173388750 20:42612346-42612368 TTCTGAAAGAATGGGGAAGAGGG + Intronic
1176980592 21:15376681-15376703 TTCTAGATGAAGAAAGAAAAGGG + Intergenic
1177441356 21:21130798-21130820 TTCTGGGTGAATATTTAAAATGG + Intronic
1177617088 21:23537046-23537068 TTCTGCATGTTTGGGGAAAATGG - Intergenic
1178241015 21:30900757-30900779 TTCTTGCTGAAGAGGGACAAGGG + Intergenic
1178907362 21:36647768-36647790 TTCTAGAAGGTTAGGGAAAAGGG - Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184428511 22:44427393-44427415 TTCTGGATGATACGGGAAATTGG - Intergenic
950563386 3:13749018-13749040 TTCTGGCTGCATCAGGAAAAGGG - Intergenic
950857491 3:16119391-16119413 TTCAGAATAAATAGGAAAAAGGG + Intergenic
950987504 3:17390880-17390902 GTTTGGTTGAATAGGGAGAATGG - Intronic
951875989 3:27426333-27426355 TTCTGGAAGTTTAGGGACAAAGG - Intronic
955280994 3:57594882-57594904 ATGTGCATGAACAGGGAAAAAGG - Intronic
955695472 3:61631748-61631770 TTCTGGATCAGTAGAGAAAAGGG + Intronic
956063423 3:65371790-65371812 TTATGGATGAACAAAGAAAATGG - Intronic
956758175 3:72410845-72410867 TTTTGAATGCATAGGGGAAAAGG + Intronic
958108291 3:89105683-89105705 TTCTGGACAGATGGGGAAAAGGG - Intergenic
959746764 3:109784347-109784369 ATCTGCATTAATAGGAAAAATGG + Intergenic
959807570 3:110575473-110575495 TTCTGGAGAAATTAGGAAAATGG - Intergenic
960026002 3:113010483-113010505 TTCTGAATGAATAGAGGCAAGGG - Intronic
960174897 3:114505488-114505510 TTCTAGCTGAAGAGGGTAAATGG + Intronic
960549002 3:118952518-118952540 TTCTGGATGAGCAAAGAAAATGG - Intronic
960867489 3:122216564-122216586 TGCTGCATAAATAGGGAATAAGG + Intronic
962629105 3:137258065-137258087 TTCTGACTGACTAGGGAGAATGG + Intergenic
964167168 3:153722502-153722524 TTCTGCCTGAAGAGGGAAAAGGG + Intergenic
964440055 3:156699110-156699132 TTTTGGATGAGTAGAGAAAGTGG + Intronic
965215968 3:165865176-165865198 TTCTGGATGAATGGTGAGCAAGG + Intergenic
966024085 3:175253924-175253946 TTATGGATGAATAACGAAAGTGG + Intronic
966107087 3:176349090-176349112 TTTTGTATGAATAGAGAAACTGG + Intergenic
967325717 3:188237143-188237165 TTATGGATGAACAGAGAAAATGG - Intronic
967592599 3:191296140-191296162 TTGTGGTTGAATTGTGAAAAGGG - Intronic
967914174 3:194565941-194565963 CTCTGTATGAACAGGCAAAAAGG - Intergenic
969070304 4:4531729-4531751 TTCTGGATGAGTATAGAAAAAGG - Intronic
971556533 4:28019461-28019483 TTGTGGATGAATTGGAAATAGGG - Intergenic
971764800 4:30816819-30816841 ATCAGAAAGAATAGGGAAAAGGG + Intronic
972385981 4:38565919-38565941 TGTAGGATGAAAAGGGAAAAGGG + Intergenic
974499048 4:62674085-62674107 TCCTGGATGAATAAGGTCAATGG + Intergenic
974668993 4:65003967-65003989 TTCTGGAAGTATAAGGCAAATGG - Intergenic
974701696 4:65457457-65457479 TAGTGGAAGAATAGGGGAAAAGG - Intronic
975238913 4:72033223-72033245 TTATGGATGAATTTGCAAAATGG + Intronic
976805648 4:89043537-89043559 CTCAGGATGAGTAGGAAAAAAGG + Intronic
977800513 4:101224699-101224721 TTCTGAATAAATAAGGAAATCGG + Intronic
978235590 4:106454753-106454775 CTCTGGATGAAGAGAGAAAGAGG + Intergenic
980174018 4:129323369-129323391 TTATGAAAGAAAAGGGAAAAGGG - Intergenic
981718487 4:147775581-147775603 TTCTGGGTGAAAAGGAAACAAGG - Intronic
981860626 4:149351851-149351873 TTCTGTATGAGTAGGAAGAAAGG - Intergenic
985338074 4:188917303-188917325 TTATGGATGAACAAGGAAAGTGG - Intergenic
985350059 4:189050648-189050670 GTGTGGATGAATAGGGAACGTGG - Intergenic
986232998 5:5884033-5884055 CTCTGGATGCATTGGGAAGATGG - Intergenic
988235520 5:28538538-28538560 TTCTGAATGAAATGGGAACAGGG - Intergenic
988931000 5:36035563-36035585 TTCTTGAAGAACAGGAAAAATGG - Exonic
989438167 5:41438609-41438631 TATTGGGTGAAAAGGGAAAAAGG - Intronic
989546067 5:42675050-42675072 TTCTGGTTGGTTAGGGTAAAAGG - Intronic
990006799 5:50953760-50953782 TGCTTGAGGAATGGGGAAAATGG - Intergenic
990808312 5:59692108-59692130 TTCTTAATGTATAGGAAAAAAGG + Intronic
992607671 5:78476068-78476090 TTCAATATAAATAGGGAAAAAGG - Exonic
992873236 5:81026389-81026411 TGTTGGATGAAGAGGCAAAAAGG - Intronic
994298610 5:98120143-98120165 TTCAGGAAGAAGAGGAAAAATGG - Intergenic
995328435 5:110918957-110918979 TACAGCATGAAAAGGGAAAAAGG - Intergenic
995954841 5:117764645-117764667 TTCTAAATGAATAGGGAAAATGG - Intergenic
995963782 5:117878837-117878859 TTCTGAATTATTAGTGAAAATGG + Intergenic
996386571 5:122915279-122915301 CTCAGGGTGAATAGGGAAGATGG - Intronic
998267676 5:140678291-140678313 TTCTGGATGAATAGGGAAAATGG - Intronic
1000771138 5:165355952-165355974 TTTTGGATGAATTGGGATAATGG + Intergenic
1003126350 6:3359027-3359049 TTCAGGATGAAGAGAGAATAGGG + Intronic
1003258668 6:4496273-4496295 TTCTGATTGACTTGGGAAAATGG - Intergenic
1004898380 6:20170840-20170862 CTCTGGATGCATTGGTAAAAAGG - Intronic
1005365523 6:25072575-25072597 TTATGGATGAACAAGGAAAATGG - Intergenic
1005578000 6:27208124-27208146 TATTGGGTGAAAAGGGAAAAAGG + Intergenic
1008880628 6:56377356-56377378 TGCTGGAGGAAGGGGGAAAATGG - Intronic
1009960890 6:70519305-70519327 TTATGGATGAACAGAGAAAGTGG + Intronic
1011513026 6:88122432-88122454 TTGTAGATGAATAGGGCACAGGG + Intergenic
1012092881 6:94921091-94921113 TTATGGATGAATAGTGAAAGTGG + Intergenic
1012304741 6:97640410-97640432 TTATGCATGAATAGGGAATATGG + Intergenic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1014236507 6:118962268-118962290 TTTGGGAAGAAAAGGGAAAAAGG + Intronic
1014495338 6:122115136-122115158 TACAGCATAAATAGGGAAAATGG - Intergenic
1015623912 6:135160181-135160203 TACAGGATGAAAAGGGAAAAGGG - Intergenic
1015740887 6:136452266-136452288 TTATGGATGAACAAAGAAAATGG + Intronic
1015889158 6:137952124-137952146 TTCTGGATGAAGAGGAAGCAGGG - Intergenic
1016616769 6:146058828-146058850 TTCTGGATGAACTAAGAAAATGG - Intronic
1017503552 6:155047116-155047138 TTCTGGATGAGTATGGGACAAGG - Intronic
1017669249 6:156754362-156754384 TACTTGATCAATAAGGAAAAGGG - Intergenic
1020459775 7:8415938-8415960 TTATGGATGAACAGAGAAAGTGG + Intergenic
1020708711 7:11578185-11578207 TTCTGGTTGAATTGAGAAAAGGG - Intronic
1020926237 7:14329484-14329506 ATCTGGAGGAACAAGGAAAATGG + Intronic
1025216346 7:57060101-57060123 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1025221221 7:57110056-57110078 GTCTGGATGAATAGTCAGAAAGG + Intergenic
1025627091 7:63232544-63232566 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1025655035 7:63510629-63510651 TTCTGGAGGCATATGGAGAAGGG + Intergenic
1027048531 7:75007169-75007191 TTCTGGCTAAATGGGGAACAGGG + Intronic
1027458946 7:78428201-78428223 CTATGGAGGAATTGGGAAAAGGG + Intronic
1027677054 7:81173005-81173027 TTCTTAATGTATAGGAAAAAAGG - Intergenic
1027735509 7:81927857-81927879 TCCTGGAGGAATGGGGCAAAGGG + Intergenic
1027925521 7:84457173-84457195 GAGTGGATGAATAGGAAAAATGG + Intronic
1029384484 7:100234480-100234502 TTCTGGCTAAATGGGGAACAGGG - Intronic
1030671112 7:112338184-112338206 TCCCGGAGGAATAGGGAAAAAGG + Intronic
1032370046 7:131340065-131340087 TTCTTAATCAAAAGGGAAAAGGG - Intronic
1033975812 7:147099192-147099214 TCTGGGATGAATAGGGAAGACGG + Intronic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034505882 7:151490550-151490572 TTCTGTAAGAATAAGGAACAGGG + Intronic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1034818004 7:154190615-154190637 TTCTGGTTCACTAGGGGAAAGGG - Intronic
1035914908 8:3608335-3608357 TTGTGGAAGAAAAGAGAAAAGGG + Intronic
1039099997 8:33930586-33930608 ACCTGGATGAAGAGGGAAGAAGG - Intergenic
1039654768 8:39390969-39390991 TTTTAAATAAATAGGGAAAATGG - Intergenic
1041190492 8:55348630-55348652 GACTGGATGAATAGAGATAATGG + Intronic
1041274234 8:56141583-56141605 CTCTGAATCAATAGGCAAAAAGG - Intergenic
1041754314 8:61296909-61296931 TTCTGGATAAAGAGAGAGAAAGG + Intronic
1041935759 8:63330132-63330154 ATGTGGATGAATAGAGAAAGGGG - Intergenic
1042202956 8:66299598-66299620 TTCTAGTAGAATAGGGAAAGGGG + Intergenic
1042322051 8:67486366-67486388 TTGCAGATCAATAGGGAAAATGG + Intronic
1047133024 8:122043083-122043105 TTCTGGTGCAATAGGGAAATTGG + Intergenic
1047266474 8:123314308-123314330 CTGTGGATGAATAGGCAAAAGGG + Intergenic
1047390836 8:124449892-124449914 ATCTGCATGAAAAGGGAAAAAGG + Intergenic
1047908741 8:129502409-129502431 TTCTGAAAGAAAAGGAAAAAGGG + Intergenic
1048316408 8:133366160-133366182 TTCCTGAGGAATGGGGAAAAGGG + Intergenic
1048321995 8:133407281-133407303 TTCTGGATGAACACAGAAATAGG - Intergenic
1048679787 8:136828177-136828199 TTCAGGGTGAATAGAGAAGATGG + Intergenic
1050858146 9:10388125-10388147 TAATGGATTAAAAGGGAAAATGG + Intronic
1050935929 9:11394427-11394449 TTATGGAAGAATAGGTAAAAAGG - Intergenic
1051271645 9:15361049-15361071 TTATGGCTGATTGGGGAAAAAGG - Intergenic
1052071719 9:24089992-24090014 TTCTGGATCACTTGGGAAAATGG + Intergenic
1052721349 9:32174773-32174795 ATCTGGATGATTAGGGAGGAAGG - Intergenic
1053529672 9:38867712-38867734 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054201897 9:62092139-62092161 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054636460 9:67496220-67496242 TGCTGGGTGGAGAGGGAAAAGGG - Intergenic
1055296939 9:74843151-74843173 TTATGGATGAATAAAGAAAATGG - Intronic
1055605943 9:77970502-77970524 TTAAGGATGAATAGGCAGAATGG - Intronic
1055726443 9:79234955-79234977 AACAGGATAAATAGGGAAAATGG + Intergenic
1056400433 9:86222518-86222540 TTCTGAATGAGTATGGAGAATGG - Intronic
1057407268 9:94784455-94784477 TTCTCAGTGAAGAGGGAAAAAGG - Intronic
1058051684 9:100412750-100412772 GTCTGGATGGATGGTGAAAATGG + Intergenic
1058546885 9:106069953-106069975 TGCTGGATGGAAAGGGAATAAGG - Intergenic
1059578807 9:115521283-115521305 TTCTGTATGAATAGGAAATGTGG + Intergenic
1060683198 9:125584135-125584157 TTCTGCATGAAGTGGGAACAAGG - Intronic
1060992932 9:127859024-127859046 TTCTGGAAGCCAAGGGAAAAAGG - Intergenic
1062319828 9:135985500-135985522 TTCTGGTAGAAGGGGGAAAAAGG - Intergenic
1186149184 X:6656134-6656156 CTCTGGAGGCATAGGGAATAGGG - Intergenic
1186395423 X:9203661-9203683 TTATGGATGAGTAGAGAAAGTGG + Intergenic
1186642879 X:11474530-11474552 TTCTGTATGACTAAGAAAAAGGG - Intronic
1187235037 X:17459141-17459163 TACTGTATGAACAGGGAAAGTGG + Intronic
1188225099 X:27587843-27587865 TGCTGGATGAATGGGGAGAGGGG - Intergenic
1188234775 X:27714749-27714771 TTTTGGAAGAGTAGGGAAAATGG - Intronic
1188613899 X:32133692-32133714 TTCTGGATGAATTGGATAAGGGG - Intronic
1189042084 X:37553559-37553581 TATTGGGTGAAAAGGGAAAAAGG + Intronic
1190576976 X:51849867-51849889 TTCTGGCGGTATAAGGAAAAGGG - Intronic
1192388733 X:70701969-70701991 TTATGGATGAATAAAGAAAGTGG + Intronic
1192528208 X:71866307-71866329 TTCTGGAGGAGTATGCAAAACGG + Intergenic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1194407356 X:93513384-93513406 TTCTGGATTAAGAAGAAAAAAGG - Intergenic
1194846340 X:98814118-98814140 TTATGGATGAATAAAGAAAGTGG - Intergenic
1195231076 X:102848580-102848602 TTCTGGATGAGTAAAGAAAGTGG - Intergenic
1195849197 X:109264704-109264726 TTCTGCATGAAAAGAGAACAGGG - Intergenic
1195860324 X:109376124-109376146 TTCTGGCTGATTGGGAAAAAAGG - Exonic
1196434219 X:115660183-115660205 ATCTGGCTGAAGAGAGAAAAAGG - Intergenic
1198334204 X:135651268-135651290 GTCTGGAGGAATAAAGAAAAGGG + Intergenic
1198675921 X:139130016-139130038 AACTGAATGAATAGGGAACAAGG + Intronic
1199829829 X:151538458-151538480 TACTGGGTGAAAAGGAAAAAAGG + Intergenic
1201866106 Y:18657121-18657143 TGCTGCATGCATAGGGAACAGGG + Intergenic