ID: 998270172

View in Genome Browser
Species Human (GRCh38)
Location 5:140699464-140699486
Sequence AAACTACCTCTTGAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998270172_998270174 1 Left 998270172 5:140699464-140699486 CCTGTCTCCTCAAGAGGTAGTTT 0: 1
1: 0
2: 0
3: 14
4: 101
Right 998270174 5:140699488-140699510 TTTGTTTGTTTGTTTTTAGACGG 0: 73
1: 2029
2: 1643
3: 6789
4: 112438
998270172_998270175 22 Left 998270172 5:140699464-140699486 CCTGTCTCCTCAAGAGGTAGTTT 0: 1
1: 0
2: 0
3: 14
4: 101
Right 998270175 5:140699509-140699531 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998270172 Original CRISPR AAACTACCTCTTGAGGAGAC AGG (reversed) Intronic
901491296 1:9597657-9597679 GACCTGCCTCTTGAGGTGACAGG - Intronic
902192616 1:14774155-14774177 AGACTGCCTCTTGGGGACACAGG - Intronic
902499592 1:16900850-16900872 AAACTAACTCCTGAGAAGATAGG + Intronic
903973122 1:27132119-27132141 AAACTGACTCTAGAGCAGACAGG + Intronic
909635158 1:77809383-77809405 ATAGTACTTCTTGAGGAGACAGG + Intronic
910559725 1:88577359-88577381 CAATTACATCTTGAGGAAACTGG + Intergenic
914910240 1:151779760-151779782 ATACAACTTCTTGAGGAAACAGG + Intronic
919807982 1:201392059-201392081 AGACTCCCTGTGGAGGAGACAGG - Intronic
920118186 1:203636080-203636102 CACCTAACTTTTGAGGAGACAGG + Intronic
920575933 1:207060268-207060290 AAACTACATGTTCAGGGGACAGG - Intronic
923977812 1:239284405-239284427 TTACTACCCCTTGGGGAGACTGG + Intergenic
1064411514 10:15108908-15108930 AAAATACCTCTTCAAGAGACAGG + Exonic
1065497620 10:26345888-26345910 AAACTGCCTCATCAGGAGAATGG + Intergenic
1065900909 10:30207175-30207197 AAAATCCCACTTGAGGGGACCGG + Intergenic
1073235514 10:102011950-102011972 ACACTACCTCAAGAGCAGACAGG - Intronic
1073719285 10:106148337-106148359 ATGCTACCTCTTGATGACACTGG + Intergenic
1076163553 10:128264580-128264602 AAACTGTCTCTGGAGGAGAGTGG + Intergenic
1079526809 11:21400224-21400246 AAACAAGCTTTTGAGGAGAGTGG - Intronic
1083624175 11:64063617-64063639 AAACCACCTCTGGAGGAGTGGGG + Intronic
1084690649 11:70723995-70724017 AACACACCTCTTGAGGAGTCAGG - Intronic
1086277906 11:85153299-85153321 AAAATACCTTTAGAGGAGATGGG - Intronic
1088055467 11:105571229-105571251 AACCTAGCTCTAGAGGAGCCTGG + Intergenic
1090394611 11:126410554-126410576 AAAATACCTATTCTGGAGACCGG + Intronic
1097345787 12:58490527-58490549 TAACTACATCTTTGGGAGACAGG + Intergenic
1106069140 13:26390088-26390110 AGGCTACCTCTGCAGGAGACAGG - Intronic
1108757676 13:53523322-53523344 CAACTTCCTCTTCAGGAGAGAGG + Intergenic
1110100453 13:71595011-71595033 TATCTACATATTGAGGAGACAGG + Intronic
1111689298 13:91541562-91541584 AAAATACCTCTTTAAGAGATGGG - Intronic
1112121598 13:96418536-96418558 GAGCTACCACTTAAGGAGACAGG - Intronic
1112919875 13:104599171-104599193 ATACTATCACTTGAGGAGAATGG + Intergenic
1114615682 14:24067063-24067085 AAACGACTTCTGGAGGAGGCTGG - Intronic
1115664140 14:35529313-35529335 AAACTACATGTTTAGGAAACAGG - Intergenic
1116095636 14:40363612-40363634 AAACTAACTCTTGAGGAACACGG - Intergenic
1116178086 14:41499064-41499086 AAACATGCTCTTGAGGAGACAGG - Intergenic
1117015822 14:51515691-51515713 AAAGAACATCTTCAGGAGACAGG + Intronic
1117395204 14:55302148-55302170 AAACTATCACTTAAGGAGCCAGG - Intronic
1121718403 14:96092349-96092371 AAACCTCCTCTTGGGGAGGCAGG - Exonic
1122146035 14:99689375-99689397 AAGTTACCTCTTGGGGAAACAGG + Intronic
1123038733 14:105481800-105481822 AAACTATGTCGTGAGGAGAGTGG + Intergenic
1126613921 15:50557237-50557259 AGACTTCCTCTTGAAGAGATGGG - Exonic
1129675368 15:77630409-77630431 AAACAACCTCTTGTGGAGGTGGG - Intronic
1129775546 15:78234043-78234065 AAAGTCCCCCTTGAGGAGACAGG + Intronic
1130770762 15:86921280-86921302 AAATTTCTTCTTGAGGAGCCTGG - Intronic
1139728538 16:68922663-68922685 AAACTGCTTCTTGAGGGGACAGG - Intronic
1139874169 16:70131970-70131992 AAAATACCTTTTGAGGTCACGGG - Intronic
1140361608 16:74349174-74349196 AAAATACCTTTTGAGGTCACGGG + Intergenic
1143783669 17:9241971-9241993 TTACTGCCTCTTGAGGACACTGG + Exonic
1144579231 17:16448754-16448776 GAACAACCACTTGAGGACACAGG + Intronic
1148496600 17:48056675-48056697 AAACTTCCTTTAGAGAAGACAGG + Intronic
1151312993 17:73305526-73305548 AAACTCCCTCCAGAGCAGACAGG + Intronic
1156067716 18:33164827-33164849 AAACTACCTCTTGCTGAGTTGGG - Intronic
1165362144 19:35343407-35343429 AAAATACCCCTGGAGGAGATGGG - Intronic
925823094 2:7819907-7819929 AAACTACCTCTTCTGGAGCCTGG + Intergenic
925828291 2:7872230-7872252 AAAAAACCACTGGAGGAGACTGG - Intergenic
927504450 2:23603897-23603919 ACAGTCCCTCTGGAGGAGACGGG - Intronic
929846480 2:45534620-45534642 AAACTGCATATAGAGGAGACAGG + Intronic
932004002 2:67909756-67909778 AGACTACCTCTAGGGGAGTCAGG - Intergenic
935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG + Intergenic
936112580 2:109677117-109677139 AAACTCCCACAGGAGGAGACAGG - Intergenic
937930770 2:127203432-127203454 AATCTACCTCCTCAGGAGCCAGG - Exonic
938784299 2:134610944-134610966 AAACTGTCTTTTGAAGAGACGGG + Intronic
945086789 2:206140171-206140193 AAAATACCTTTTGTAGAGACAGG - Intronic
945962480 2:216150081-216150103 AAACTACCTCTAGAACTGACTGG - Intronic
947995153 2:234521307-234521329 TAACTCCCTCTTGAGAAGATCGG + Intergenic
1170381218 20:15761629-15761651 AAACTAAGACATGAGGAGACAGG + Intronic
1174063657 20:47849550-47849572 AAACTACCTATTGAGGGGCCGGG - Intergenic
1175456460 20:59118738-59118760 AAGGTACCTCTTGTGGAGACAGG - Intergenic
1177016951 21:15802863-15802885 AAACTGCTTCTTGAGAAGATTGG + Intronic
1182193881 22:28493872-28493894 AAATTACTTGTTGAAGAGACAGG - Intronic
949548734 3:5095152-5095174 AAAATACCTCTTGAGGCCAGGGG + Intergenic
964459354 3:156905718-156905740 AAACTACCTTTTAAGGAAGCAGG - Intronic
967188720 3:186967166-186967188 AAAACACCTCTTCAGGAGTCTGG - Intronic
972595064 4:40522531-40522553 AAACTACCTCTTGTAGAGTTTGG + Intronic
974411279 4:61543931-61543953 AGACAAAGTCTTGAGGAGACTGG - Intronic
976022460 4:80645394-80645416 AATCTACCTCTTGAGGATGCTGG + Intronic
980267091 4:130530958-130530980 GAAATACCTCTTGAGAAGACAGG + Intergenic
984829816 4:183962005-183962027 AATCCACCTGTTGATGAGACAGG + Intronic
986836950 5:11649621-11649643 AAACAAACTCTTGATGAGATTGG + Intronic
988685751 5:33523612-33523634 AAGGTACCCCTTGAGGAGGCTGG + Exonic
989006625 5:36821770-36821792 ATACTACCTCTATAGGATACAGG - Intergenic
990204966 5:53418913-53418935 TAACTAGCTGTTTAGGAGACGGG - Intergenic
992521304 5:77554497-77554519 AAAGTACCTTTCTAGGAGACAGG + Intronic
998270172 5:140699464-140699486 AAACTACCTCTTGAGGAGACAGG - Intronic
1000317768 5:160109474-160109496 GAACTACCTCTTCAGAAGCCTGG + Intronic
1002848561 6:970397-970419 AAACTATCTATTGAGGAGGAAGG - Intergenic
1003283232 6:4712184-4712206 AGAGCACCTCTTGAGTAGACAGG + Intronic
1007706184 6:43792865-43792887 AAAGTACCTCATGAAGTGACTGG + Intergenic
1010278092 6:73991848-73991870 AAACTACCTTTTAAGTAGAAAGG - Intergenic
1014402664 6:121010219-121010241 AAACTACCTTTTGAGAATTCTGG + Intergenic
1014572592 6:123028792-123028814 AAACTACGTCATGAAGAGAAAGG - Intronic
1016875097 6:148856579-148856601 TAGCTACCTCTTGAAGAGATGGG + Intronic
1018743543 6:166747822-166747844 AAACGACCTCTGCAGGAGACAGG + Intronic
1024816803 7:53280997-53281019 CAAATACCTATGGAGGAGACAGG + Intergenic
1026623958 7:71976033-71976055 AAATTGTCTCTTGTGGAGACCGG - Intronic
1027647891 7:80827268-80827290 AACCTAAACCTTGAGGAGACTGG - Intronic
1032705230 7:134415508-134415530 AAGAGACCTCTAGAGGAGACTGG - Intergenic
1036676087 8:10834583-10834605 AAACTTCCTTCTTAGGAGACTGG - Intronic
1038847962 8:31247257-31247279 AAACTACCTCTTGAGATGCCGGG + Intergenic
1039085015 8:33771356-33771378 AAATTACCTGTTGATCAGACAGG + Intergenic
1040557844 8:48496784-48496806 AAGGTACATCTTGAAGAGACAGG + Intergenic
1043403339 8:79905382-79905404 AATCTACCTCCTGGGGAGTCAGG + Intergenic
1046652688 8:116855567-116855589 AAATTTCTTCTTGAAGAGACAGG + Intronic
1048458684 8:134601939-134601961 AAACCACCTCTTGAGAATGCAGG + Exonic
1050968495 9:11838872-11838894 AAAGTACTTCTTGAGAAGAAAGG + Intergenic
1051166743 9:14270754-14270776 AAATTACATATTGAGGTGACAGG + Intronic
1059274912 9:113088853-113088875 AAGCTGTCCCTTGAGGAGACGGG - Intergenic
1059823935 9:118005753-118005775 CAACTAGCTCTTTAGGAAACAGG - Intergenic
1060889583 9:127179492-127179514 AAACCCCCTCCTGAGGAGCCAGG - Intronic
1061987298 9:134136881-134136903 AAACTAGCATTTGAGGAGATGGG - Intronic
1186769183 X:12800797-12800819 AAACCATGTCTTGAGGAGACTGG - Intronic
1186945996 X:14568380-14568402 GCACTATTTCTTGAGGAGACTGG - Intronic
1189157905 X:38778350-38778372 AAACTTCCTCTAGATGAGACAGG + Intergenic
1189185166 X:39048705-39048727 TAACCACCTCTTGAGGATAGGGG + Intergenic
1195679556 X:107534192-107534214 AATCCAACTCTTGAGGAGAGGGG - Intronic
1197634174 X:128896173-128896195 AAACTACCTCTAGAGAATTCAGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic