ID: 998279923

View in Genome Browser
Species Human (GRCh38)
Location 5:140796278-140796300
Sequence CACCAGCGTGTCCATCGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998279919_998279923 -6 Left 998279919 5:140796261-140796283 CCTTCACTGTGGGCCACCACCAG 0: 1
1: 0
2: 9
3: 23
4: 203
Right 998279923 5:140796278-140796300 CACCAGCGTGTCCATCGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 66
998279916_998279923 14 Left 998279916 5:140796241-140796263 CCGCACGGGACGGGGGCTCGCCT 0: 1
1: 8
2: 1
3: 3
4: 52
Right 998279923 5:140796278-140796300 CACCAGCGTGTCCATCGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998279923 Original CRISPR CACCAGCGTGTCCATCGAGG TGG Exonic
903897974 1:26621101-26621123 CCGCAGCGTGTCCCTCGAAGTGG - Intergenic
906705289 1:47890342-47890364 GACCAGCGTGGTCATGGAGGTGG + Intronic
912630742 1:111244604-111244626 CACCAGAATGTCCGTGGAGGAGG + Intergenic
913338710 1:117734581-117734603 CACCAGCATGTTCATCCAAGGGG - Intergenic
915339528 1:155168737-155168759 CACCTGCATTTCCATCAAGGTGG + Intergenic
921273385 1:213492132-213492154 CACCATTGTGTGCATAGAGGAGG + Intergenic
922349597 1:224724334-224724356 CACCAGCCTGGGCATCCAGGAGG - Intronic
923888145 1:238180712-238180734 CACCAACCTGTCCAACAAGGGGG + Intergenic
1069893158 10:71664484-71664506 CAGCAGCGGGTCCGTGGAGGTGG - Intronic
1075891333 10:125953784-125953806 CAGCAGCGTGCCCAGCTAGGAGG - Intronic
1083609258 11:63997408-63997430 CCTCAGCGTGTCCATCCAGGTGG + Exonic
1090078738 11:123596182-123596204 CCCCAGCCTGTCCACCCAGGAGG - Intronic
1092001756 12:5038621-5038643 CACCAGCCTGCCCGTGGAGGAGG + Intergenic
1092596751 12:10014629-10014651 CAACAACTTGTCCATGGAGGAGG + Exonic
1096818424 12:54216166-54216188 CACCCAGGTGTCCATCCAGGTGG + Intergenic
1098835530 12:75420269-75420291 CACCATCTTGTTCATCAAGGAGG - Intronic
1101445012 12:104731370-104731392 CTCCAGCCTGTGCAGCGAGGTGG + Intronic
1102109420 12:110353367-110353389 CACCAGAGTGTACATCAACGTGG + Intergenic
1103622998 12:122200303-122200325 GACCACCGTGACCATCGTGGAGG + Exonic
1104528173 12:129543887-129543909 CACCTCTGTGTCCATCGAGGGGG - Intronic
1114219406 14:20683349-20683371 CAGCAGCGTCTCCTTCGAGCCGG - Intergenic
1115925910 14:38434393-38434415 CACCAGGGAGTCCATCTAGAAGG - Intergenic
1121835839 14:97091485-97091507 CAGCTGTGTGTCCATAGAGGTGG - Intergenic
1128308474 15:66615538-66615560 CATCTGCCTGTCCATCCAGGGGG - Intronic
1134573157 16:15309159-15309181 GACCAGCGTGGCCAACAAGGGGG - Intergenic
1134729226 16:16446799-16446821 GACCAGCGTGGCCAACAAGGGGG + Intergenic
1134938209 16:18265065-18265087 GACCAGCGTGGCCAACAAGGGGG - Intergenic
1142263982 16:89055209-89055231 CACCAGCGTGTCCAGCTGTGGGG + Intergenic
1144792640 17:17869401-17869423 CTCCCGCGTGTCCAATGAGGAGG - Exonic
1144844376 17:18208605-18208627 CAACAGCCTTTCCATCCAGGAGG - Exonic
1152487372 17:80602817-80602839 CACCAGCGCGTCCACGGAGTGGG - Intronic
1152994522 18:394127-394149 CAGCAGCTTGTCCATTGATGAGG + Intronic
1157192843 18:45595887-45595909 CCCCAGGGTGTTCATTGAGGAGG + Intronic
1160716212 19:577981-578003 CACGAGCGTGTCGATGGAGATGG - Exonic
1162120944 19:8467825-8467847 CACCAGCCTGACCAACGTGGTGG + Intronic
1163462631 19:17448229-17448251 CACCAGCGCGGCCAGCGCGGCGG + Exonic
925440213 2:3879229-3879251 CACCAGGGTGTCTAAAGAGGAGG + Intergenic
926189849 2:10720770-10720792 CTCAAGAGTGTCCTTCGAGGGGG - Intergenic
929778869 2:44944673-44944695 CACCAGCGTGTCCAGCCTGACGG + Exonic
935919573 2:107997845-107997867 CATCAGCGTGATCATCGATGTGG + Exonic
1171190030 20:23152187-23152209 CACCCGAGTTTCCATCAAGGAGG + Intergenic
1179156762 21:38857767-38857789 CACCAGCAGGTCCATGGAGAAGG + Intergenic
1180698654 22:17769990-17770012 CAGCAGCGTGTCCCTCCTGGGGG - Intronic
1183523909 22:38312609-38312631 CTCCAGGGTGTCCATAGGGGAGG + Intronic
1184759283 22:46535823-46535845 GGCCACCGTGTACATCGAGGTGG - Exonic
1185150119 22:49159483-49159505 CACCAGATTGTCCATCAGGGCGG + Intergenic
1185349453 22:50326974-50326996 CAACAGCGCGTCCATGGCGGCGG + Exonic
969609105 4:8217102-8217124 CCCCAGCGTGTCCTCCGAGGAGG + Exonic
986733981 5:10654692-10654714 CACCTCCGTGTGCATGGAGGCGG + Intergenic
987631469 5:20478258-20478280 CACCAGCTTGGCCATAGTGGGGG + Intronic
996550598 5:124726191-124726213 CAGCGCCGTGTCCATTGAGGGGG - Intronic
998279923 5:140796278-140796300 CACCAGCGTGTCCATCGAGGTGG + Exonic
998280494 5:140802511-140802533 GGCCAGCGTGTCCGTGGAGGTGG + Exonic
1000022794 5:157333164-157333186 AACCAGCCTGTCCATTGAGGTGG - Intronic
1001113648 5:168920496-168920518 CACCAGCGAGACCATCACGGCGG + Intronic
1006034796 6:31202730-31202752 CTCCAGCATTTCCATTGAGGAGG - Exonic
1006073802 6:31516310-31516332 CCCCAGCATCTCCATAGAGGAGG - Intergenic
1014780453 6:125559220-125559242 GACCAACGTGTCCATCCTGGAGG - Intergenic
1016366790 6:143327365-143327387 CACAAGCGCGTCCATGGAGTGGG + Intronic
1017062668 6:150499915-150499937 CATCAGCATGACCATGGAGGAGG - Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1026410598 7:70117945-70117967 GACCAGCCTGACCAACGAGGTGG - Intronic
1034999686 7:155603008-155603030 CACCAGCGTGGGCATCCTGGAGG - Intergenic
1035379994 7:158431834-158431856 CACCAGCCTGTCCCTCGGGTGGG - Intronic
1056935246 9:90911252-90911274 TACCAGCCTGTCCACTGAGGTGG + Intergenic
1189284277 X:39840494-39840516 CACCAGCGGGTCCTTGCAGGAGG + Intergenic
1190690230 X:52907677-52907699 CACCAGCGTCTCCCAGGAGGAGG - Exonic
1190695753 X:52948115-52948137 CACCAGCGTCTCCCAGGAGGAGG + Exonic
1198114960 X:133536150-133536172 CACCAGCATGGCCATCTCGGTGG - Exonic
1199259361 X:145753100-145753122 CACCAGCGTGTCCAAGCTGGAGG - Intergenic
1200223631 X:154404632-154404654 CGCCAGAGTGTCCATAGAGCAGG - Intronic