ID: 998280742

View in Genome Browser
Species Human (GRCh38)
Location 5:140804808-140804830
Sequence AGTATTAACCAGGTTTCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998280742_998280744 -9 Left 998280742 5:140804808-140804830 CCAACTGAAACCTGGTTAATACT 0: 1
1: 0
2: 0
3: 6
4: 126
Right 998280744 5:140804822-140804844 GTTAATACTCATTGACAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 122
998280742_998280745 -8 Left 998280742 5:140804808-140804830 CCAACTGAAACCTGGTTAATACT 0: 1
1: 0
2: 0
3: 6
4: 126
Right 998280745 5:140804823-140804845 TTAATACTCATTGACAGTGTGGG 0: 1
1: 0
2: 0
3: 13
4: 147
998280742_998280746 -5 Left 998280742 5:140804808-140804830 CCAACTGAAACCTGGTTAATACT 0: 1
1: 0
2: 0
3: 6
4: 126
Right 998280746 5:140804826-140804848 ATACTCATTGACAGTGTGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998280742 Original CRISPR AGTATTAACCAGGTTTCAGT TGG (reversed) Intronic
902749418 1:18496904-18496926 AGTATAAACAAGATTTCAGAAGG + Intergenic
903157596 1:21458223-21458245 AGTATTAAACAAGTTTTATTGGG - Intronic
906804680 1:48769272-48769294 ATTGCTAGCCAGGTTTCAGTAGG + Intronic
906974990 1:50560812-50560834 AGTATTAACCAGTAATAAGTGGG - Intronic
907598270 1:55740731-55740753 AGAAAGAACCAGATTTCAGTGGG - Intergenic
909358849 1:74739557-74739579 AGTATATACAAAGTTTCAGTGGG + Intronic
910281473 1:85506215-85506237 AGTATTCACCAGATTTCACCAGG + Intronic
910464809 1:87487065-87487087 AGAATTAATCAGGTTTAAGCTGG - Intergenic
913544622 1:119855165-119855187 AGTATTAAACAAGTTTTATTGGG + Intergenic
914959126 1:152190491-152190513 AGTATTAAATAGGCTTCATTAGG + Intergenic
916347841 1:163814367-163814389 AGTATTGTCCATGTTTCAGAAGG - Intergenic
916687841 1:167163277-167163299 AGTAATAAACAGGTCTCAGGAGG + Intergenic
916764260 1:167845157-167845179 AGTTTGAAACAGGTTCCAGTGGG - Intronic
918115515 1:181493089-181493111 AGCATCAACCAGATGTCAGTAGG - Intronic
921943731 1:220871560-220871582 TATATTAAACATGTTTCAGTTGG + Intergenic
1063576509 10:7266500-7266522 AGGAGTAAGCAGGTGTCAGTGGG + Intronic
1067112930 10:43413367-43413389 GGTTGTTACCAGGTTTCAGTGGG - Intergenic
1068474152 10:57504360-57504382 AGTGAAAAGCAGGTTTCAGTGGG + Intergenic
1073169462 10:101491368-101491390 ATTAATAACCAAGTTTAAGTGGG - Intronic
1075079142 10:119371153-119371175 AGTCCCAAGCAGGTTTCAGTGGG + Intronic
1076163231 10:128262113-128262135 AGAATTAACCAGGTCTTTGTGGG + Intergenic
1079980589 11:27147665-27147687 AGTAGTAGCCAGGGTTTAGTAGG + Intergenic
1080252963 11:30256805-30256827 GGTATTAACCAGGCTTCAGAGGG + Intergenic
1081194297 11:40142349-40142371 AGTATTAACTACCCTTCAGTAGG + Intronic
1083045686 11:59732870-59732892 AGGATTAACCAAGTTTTATTGGG + Intronic
1088177477 11:107070229-107070251 ACTATAAACCAGATCTCAGTAGG - Intergenic
1091481301 12:834478-834500 AGTAATATCCAGGATTCAATGGG + Intronic
1094824836 12:34261832-34261854 AGGATTGCCCAGGTTACAGTGGG - Intergenic
1097566350 12:61273771-61273793 AGCATTAAACATTTTTCAGTAGG - Intergenic
1098089966 12:66891276-66891298 AATATTAAGTAGGTTGCAGTTGG + Intergenic
1100935539 12:99661091-99661113 AGTATTAAACAGGTTTTACTGGG + Intronic
1100936215 12:99670014-99670036 AGTATTCAGCAGTTTTCAGAAGG + Intronic
1106074355 13:26444768-26444790 AGTATTAACTCAGTTTCACTGGG - Intergenic
1108791263 13:53972040-53972062 AGTATTACCCAGCTGTCAGGTGG - Intergenic
1109064796 13:57673250-57673272 AGGATTAAACAGGTTTTACTGGG - Intronic
1110527484 13:76555788-76555810 AGTTTTCTGCAGGTTTCAGTAGG - Intergenic
1116267988 14:42720672-42720694 AGGATTAAGCAAGTTTCATTGGG - Intergenic
1118240117 14:64047673-64047695 AGTGTTCACCAGGATACAGTGGG - Intronic
1119054994 14:71410260-71410282 AGTACTAAGCATATTTCAGTAGG + Intronic
1122890576 14:104730305-104730327 AGTAGAAACCGGGTTTCACTTGG - Intronic
1129185591 15:73904217-73904239 AGAACTAACCAGGTTGGAGTGGG + Intergenic
1133961741 16:10500942-10500964 AGGATTAAACAAGTTTCATTGGG + Intergenic
1145841330 17:27997569-27997591 AGGATTAAGCTGGTTTGAGTTGG - Intergenic
1145882590 17:28363366-28363388 GGTATTACCCAGGCTTCAGCTGG - Exonic
1147300690 17:39524335-39524357 AGTATTGGTCAAGTTTCAGTAGG - Intronic
1148253239 17:46104997-46105019 AGTAGAAACAAGGTTTCACTTGG + Intronic
1152365513 17:79854118-79854140 GGTAAGAACCAGGTGTCAGTAGG + Intergenic
1153754135 18:8263005-8263027 AGTATTGATCAGGTTCAAGTTGG - Intronic
1154081830 18:11264885-11264907 AGGATTAAACAGGTTTTATTGGG - Intergenic
1154193707 18:12251140-12251162 ACTTTTTACCAAGTTTCAGTGGG - Intergenic
1154403252 18:14063018-14063040 ATTATTAACCATGTTTTAGGTGG - Intronic
1155881383 18:31152989-31153011 AGAATTACCCATGTTTCTGTAGG - Intronic
1156589353 18:38468534-38468556 ATTATTAACCAGCTACCAGTAGG + Intergenic
1157869938 18:51220743-51220765 ACTATTAACCAGGATACAGAAGG - Intergenic
1165749256 19:38250416-38250438 AGGATTAACCTGGGTTCAATAGG + Intronic
926986468 2:18630197-18630219 ACTATAAATCAGGTATCAGTGGG - Intergenic
927899479 2:26808982-26809004 AGTCTTAAAAAGGTTTAAGTAGG - Intergenic
936753385 2:115674650-115674672 AGTAATAACCAGGTTAATGTGGG + Intronic
937306163 2:120872327-120872349 GGAATTAACCAGCTTACAGTGGG + Intronic
939532190 2:143377666-143377688 AGTGTTAAAAAGGTTTGAGTTGG + Intronic
939545734 2:143550545-143550567 TGTATTAACCACGTTTCAAGTGG + Intronic
1169965815 20:11216016-11216038 AGTACTTGCCAGGTTTCAGTGGG - Intergenic
1170322174 20:15112034-15112056 GGTATTTATCAGGTTTCAATAGG - Intronic
1172647732 20:36481801-36481823 AGTATTATCCAGAGTTCAGTGGG + Intronic
1172713660 20:36947160-36947182 AGAATTAACAAGGTTTGAGTTGG + Intronic
1173339476 20:42140772-42140794 TTTATTAACCAGGATTCACTGGG - Intronic
1176548345 21:8211455-8211477 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1176556238 21:8255660-8255682 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1176567276 21:8394490-8394512 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1176575175 21:8438700-8438722 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1181449484 22:23009283-23009305 AGAATTAAGCAAGTTTCATTGGG + Intergenic
1182186066 22:28403761-28403783 AGTATTAGACAGGTTTTACTCGG + Intronic
1182747992 22:32620551-32620573 AGCATATACCTGGTTTCAGTGGG + Intronic
1184269177 22:43368814-43368836 AATATTAACCAGATCTCAGGAGG - Intergenic
1203253224 22_KI270733v1_random:127755-127777 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1203261279 22_KI270733v1_random:172836-172858 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
953552253 3:43912608-43912630 AGTGTTAATCAGGTTGGAGTTGG - Intergenic
963776772 3:149447903-149447925 AATATTAACCAGGATTTATTTGG - Intergenic
965679562 3:171236086-171236108 AGGATTAAACAGGTTTAAGGTGG - Intronic
966451363 3:180066581-180066603 AGTATTAATCAGGTCTCCTTTGG - Intergenic
970715953 4:18923366-18923388 ATTATTCACCATTTTTCAGTTGG - Intergenic
974027355 4:56745523-56745545 TGTATTCACCAGGTTACAGGAGG - Intergenic
974799603 4:66800062-66800084 TATATTTACCAGGATTCAGTGGG - Intergenic
979166606 4:117540266-117540288 AGGATTTACCAGGTTTCTGAAGG + Intergenic
979834875 4:125353091-125353113 AGTATTAACAATGTTTCCTTTGG - Intronic
983744390 4:171178139-171178161 TGGAATATCCAGGTTTCAGTTGG - Intergenic
986185869 5:5437215-5437237 AGTACTTAACAGGCTTCAGTAGG + Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
992193194 5:74314222-74314244 AGTATTATCCACATTTCATTTGG + Intergenic
993112862 5:83680454-83680476 AGTATTTAGCATGTTTCTGTAGG + Intronic
996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG + Intergenic
996555309 5:124772410-124772432 AAAATTACCCAGGCTTCAGTTGG + Intergenic
996800775 5:127400327-127400349 AGTACTGAGCAGGTTTGAGTAGG + Intronic
998280742 5:140804808-140804830 AGTATTAACCAGGTTTCAGTTGG - Intronic
999604418 5:153298466-153298488 AGTATTTGCTAGGTTTAAGTAGG + Intergenic
1004325782 6:14672921-14672943 AGTATTTACCAGGGTCCAGAAGG - Intergenic
1005565007 6:27082564-27082586 AGTACTTACAAGTTTTCAGTGGG - Intergenic
1008651677 6:53570224-53570246 AGTATTAAACAAGTTTTACTGGG - Intronic
1009200356 6:60736792-60736814 AGTATTGACCAGTTTTGAGGTGG - Intergenic
1009607617 6:65894781-65894803 ACAATGAACCAGGGTTCAGTTGG - Intergenic
1010277591 6:73987936-73987958 AGTATTAATGAGGTTCCAGCTGG - Intergenic
1010406237 6:75509079-75509101 ACTACAAACCAGGTTTCAGTAGG + Intergenic
1015244379 6:131061631-131061653 AGCTTTGAACAGGTTTCAGTGGG - Intronic
1015934382 6:138393848-138393870 AGGCTGAATCAGGTTTCAGTTGG + Intergenic
1022896214 7:34752401-34752423 AGGATTAAACAAGTTTCACTGGG - Intronic
1026561382 7:71453188-71453210 AGTGCTAACCAGATTTCATTTGG + Intronic
1029893961 7:103961858-103961880 AGTATTAGCTACCTTTCAGTAGG + Intronic
1034062971 7:148110010-148110032 AGGATTAAACAAGTTTCATTGGG - Intronic
1035722097 8:1799592-1799614 ATTTTTAGCCAGGTTTCAGCAGG + Intergenic
1035888347 8:3317658-3317680 AGTATTAACCAGATAACTGTAGG - Intronic
1038156270 8:24993616-24993638 AGTATTATCCAAGTATCTGTAGG - Intergenic
1041315222 8:56554273-56554295 AGTATCAACTAGGGTTCACTAGG + Intergenic
1043540620 8:81258186-81258208 AGTATCAGCCAGGCTTCTGTTGG + Intergenic
1045356580 8:101394812-101394834 AGTATAAACCAAGTTCCAGATGG - Intergenic
1046990164 8:120444351-120444373 AGATTGAACCAGGTTTCAGGTGG - Intronic
1050915773 9:11129781-11129803 AAAAGTAACCAGGTTTCAGACGG + Intergenic
1051755654 9:20397023-20397045 AGAATCAAGCAGTTTTCAGTGGG + Intronic
1052179962 9:25513745-25513767 AGTGTTAACCTGTTTTCAGCAGG + Intergenic
1053551338 9:39082324-39082346 TCCATTAACCAGGATTCAGTGGG - Intronic
1053815451 9:41902442-41902464 TCCATTAACCAGGATTCAGTGGG - Intronic
1054615145 9:67284998-67285020 TCCATTAACCAGGATTCAGTGGG + Intergenic
1056092729 9:83219898-83219920 ATTATTAACCAGGCTGCAGCCGG - Intergenic
1057453450 9:95186719-95186741 AGAAGTAACCTGGTATCAGTGGG - Intronic
1057557702 9:96100712-96100734 AGTATGAATCAGGTTGCTGTTGG - Intergenic
1059236063 9:112761544-112761566 AGAATTAACCTGGTTTTGGTTGG + Intronic
1062249469 9:135587089-135587111 AATATTAACAAGGTTTATGTGGG - Intergenic
1203469626 Un_GL000220v1:110902-110924 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1203477447 Un_GL000220v1:154874-154896 AGTCGTAACAAGGTTTCCGTAGG + Intergenic
1185799256 X:2995006-2995028 AGGATTAAACAGGTTTTATTGGG - Intergenic
1186582156 X:10831591-10831613 AGTATTAACAAAGTTCCAGGAGG - Intronic
1187250712 X:17595522-17595544 AGTATTAACAAGATTTGAGAGGG - Intronic
1192772225 X:74204786-74204808 ATTATTAACCTGGCTTCAATTGG - Intergenic
1198434154 X:136598917-136598939 AGTATTAGTCAGTTTTCAGATGG - Intergenic