ID: 998281187

View in Genome Browser
Species Human (GRCh38)
Location 5:140808931-140808953
Sequence TGGCCCACACCCACCGACCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998281187_998281195 16 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281195 5:140808970-140808992 CGCGCGGTGGATGCTGACTCGGG 0: 1
1: 1
2: 4
3: 6
4: 41
998281187_998281192 0 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281192 5:140808954-140808976 CGTGGTGGCAAAGGTGCGCGCGG 0: 1
1: 1
2: 2
3: 4
4: 90
998281187_998281196 29 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281196 5:140808983-140809005 CTGACTCGGGCTACAACGCGTGG 0: 1
1: 5
2: 6
3: 4
4: 20
998281187_998281190 -9 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281190 5:140808945-140808967 TGTGGGCCACGTGGTGGCAAAGG 0: 1
1: 0
2: 4
3: 17
4: 157
998281187_998281194 15 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281194 5:140808969-140808991 GCGCGCGGTGGATGCTGACTCGG 0: 1
1: 0
2: 0
3: 7
4: 43
998281187_998281193 3 Left 998281187 5:140808931-140808953 CCATGGTCGGTGGGTGTGGGCCA 0: 1
1: 0
2: 2
3: 15
4: 129
Right 998281193 5:140808957-140808979 GGTGGCAAAGGTGCGCGCGGTGG 0: 1
1: 1
2: 7
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998281187 Original CRISPR TGGCCCACACCCACCGACCA TGG (reversed) Exonic
900604822 1:3519241-3519263 TGGTCCAGACCCACTGGCCAAGG + Intronic
900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG + Exonic
902331471 1:15733033-15733055 AGTCCCACACCCACCTCCCAGGG - Intronic
902331995 1:15735280-15735302 AGTCCCACACCCACCTCCCAGGG - Intergenic
903013257 1:20345054-20345076 TGGTCCCCACCCACCAGCCAGGG + Intronic
904674772 1:32192233-32192255 AGCCCCACAGCCACAGACCAGGG - Intronic
904995887 1:34630992-34631014 TGACCCCCACCCACCCACAAGGG + Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
907054984 1:51358062-51358084 TGGCCCACACCCACAGAACTAGG - Intronic
907400979 1:54224640-54224662 TGTCTCCCACCCACCCACCACGG + Intronic
909685681 1:78345757-78345779 TTGCCCACACTCATCCACCAGGG - Intronic
913538158 1:119794119-119794141 TGGCCCACATCAACCTAGCAAGG + Exonic
914342458 1:146771595-146771617 TGGCCCAGAACCTCCGTCCAGGG - Intergenic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
917792541 1:178508525-178508547 TAGGCCCCACCCACCGAACATGG - Intergenic
918696305 1:187550655-187550677 TGGCACACACCCAAAGACCAAGG + Intergenic
921094624 1:211875695-211875717 TCCCCCACTCCCACCCACCAGGG + Intergenic
923768655 1:236917173-236917195 TTGCCCACTCCTACCCACCAAGG - Intergenic
1065115010 10:22476469-22476491 TGGCCCACACCCGGGGACCGCGG + Intergenic
1065847877 10:29761250-29761272 TCTCCCACATCTACCGACCATGG + Intergenic
1067078244 10:43200101-43200123 AGGCCCACACCCACCCTGCATGG + Intronic
1067078598 10:43201763-43201785 TGGCACACACCCAAAGACCCTGG + Intronic
1067103495 10:43350047-43350069 TGGCCCCCACCCAGTGGCCAAGG + Intergenic
1067416311 10:46106118-46106140 TGGCCCCCTCCCACCCTCCAGGG + Intergenic
1067495521 10:46757191-46757213 TGTCCCACCCCCACCGGCCCTGG - Intergenic
1067599132 10:47583197-47583219 TGTCCCACCCCCACCGGCCCTGG + Intergenic
1067948793 10:50709782-50709804 TGTCCCACCCCCACCGGCCCTGG + Intergenic
1068121540 10:52786151-52786173 CGGCCCAAAGCCACTGACCATGG + Intergenic
1069714798 10:70513890-70513912 TGGCCCACACCCGGTGACCCAGG + Intronic
1073313135 10:102558587-102558609 TGGACCACTGCCACCAACCAAGG - Intronic
1074214916 10:111374838-111374860 GGGACCACACCCACAGACCTGGG - Intergenic
1077124045 11:924753-924775 TGGCCCAGACCCACCAGCCAGGG - Intergenic
1077145314 11:1041841-1041863 TGGCACACAGCCACCTCCCATGG - Intergenic
1077544325 11:3162661-3162683 TGGCCAAGACCCAGCCACCAAGG + Intronic
1079096151 11:17511613-17511635 AGACTCACACCCCCCGACCAAGG + Intronic
1080586894 11:33690777-33690799 TGGCCCACACCCAACAGACAAGG - Intergenic
1081984691 11:47293047-47293069 TGTCCCCCACCCACCCACAATGG - Intronic
1083263952 11:61537633-61537655 TGCCCCAGACCCTCCCACCATGG + Intronic
1089063834 11:115646992-115647014 TGGCCCCCACCCACAGCCCAAGG - Intergenic
1090460510 11:126887602-126887624 TCTCCCACCCCCACCAACCAAGG + Intronic
1091955840 12:4641462-4641484 TGGCCCACACCTGCAGGCCAAGG - Intronic
1096588586 12:52642449-52642471 TGGGCCACACCCTCCCACCAGGG - Intergenic
1098139821 12:67440040-67440062 TGGCCCACAACAAATGACCAAGG + Intergenic
1098439759 12:70504966-70504988 GAGCCCCCACCCACCAACCAAGG - Intergenic
1104002521 12:124869130-124869152 TCATCCACACACACCGACCAAGG - Intronic
1105628231 13:22134929-22134951 TCACCCACATCCACCCACCAGGG + Intergenic
1113941042 13:114018727-114018749 CTGCCCACACCCACAGGCCACGG + Intronic
1117547558 14:56805547-56805569 TGCTCCAAACCCACCCACCAAGG - Exonic
1117797376 14:59408465-59408487 TGTCCCACACCCCCAGACCAAGG + Intergenic
1117816816 14:59607244-59607266 GAGCCCTCACCCACTGACCAGGG - Intronic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1123706579 15:22955309-22955331 GGGCCCACAGCCACAGAGCAAGG + Intronic
1124658237 15:31525508-31525530 GGGTCCTCACCCACCCACCAAGG - Intronic
1126501574 15:49351837-49351859 TAGCCCACATCCACTGACTAAGG - Intronic
1128485246 15:68079597-68079619 TGGCACACACCTACAGACCCAGG - Intronic
1142251219 16:88992906-88992928 TCCCCCACCCCCACCGCCCAGGG + Intergenic
1143514690 17:7413869-7413891 CACCCCTCACCCACCGACCAGGG + Intronic
1144407509 17:14966473-14966495 TGGCCCCCAGCCACCATCCAGGG - Intergenic
1150905067 17:69327729-69327751 TGGCCCTCACACCCCGACCTGGG + Intergenic
1152084953 17:78212309-78212331 TGGCCCCCAGGCACAGACCAAGG - Intergenic
1156034718 18:32753616-32753638 TAGCCCACCCCCACCACCCAAGG + Intronic
1157485287 18:48082731-48082753 GGGCCCATACCCACCCAGCAAGG - Intronic
1160882198 19:1325994-1326016 TGGCTCACACCCGCCGGGCACGG + Intergenic
1164403992 19:27925454-27925476 TGGTCCACCCTCACCCACCAAGG - Intergenic
1165241747 19:34474344-34474366 TGGCCTACACCCAAGGAACATGG + Intergenic
1165934949 19:39383559-39383581 TGGCCCCCGCCCGCCGCCCAGGG - Exonic
1166069430 19:40378418-40378440 TGGCCCACCCCCACTTTCCAGGG + Exonic
926044888 2:9703238-9703260 TGTCCCACAAACACCAACCAGGG - Intergenic
927692067 2:25215522-25215544 TGGCCCACAGCCTCCTCCCAGGG - Intergenic
928275327 2:29895489-29895511 AGGCTCACAGCCACAGACCAGGG - Intronic
928404986 2:31007945-31007967 TGGCCCACAACCTCTGAGCAGGG + Intronic
931743067 2:65266400-65266422 TGGCACACTCCCACCAACCTGGG - Intronic
931765142 2:65448791-65448813 TGGCACACACCCAGCTACTAGGG - Intergenic
931906455 2:66848783-66848805 TGCCCCACACCCCCCACCCAGGG + Intergenic
934504189 2:94878774-94878796 TCGCCCCCACCCACCTCCCATGG - Intergenic
948157227 2:235793151-235793173 TGGACCACTCCCAGTGACCATGG + Intronic
948495365 2:238345369-238345391 TGGGCCACCCTCACCAACCAAGG - Intronic
1169257426 20:4109917-4109939 TGCCCCTCACCCACCCACCCAGG - Intergenic
1175782361 20:61690703-61690725 CACCCCCCACCCACCGACCAGGG + Intronic
1175943521 20:62548579-62548601 AGCCCCACACCCACGGACCAGGG - Intergenic
1176102434 20:63370560-63370582 TGGCACTCACCCACCCACCAAGG - Intronic
1176298566 21:5087650-5087672 TGGCCCAGACCCACAGGGCAGGG + Intergenic
1179858460 21:44174299-44174321 TGGCCCAGACCCACAGGGCAGGG - Intergenic
1180005682 21:45019373-45019395 TGGGCCGCACCCGCCGACCTGGG + Intergenic
1180049073 21:45323187-45323209 TGGCCCACACCCACGGAAGCAGG + Intergenic
1181568289 22:23752567-23752589 TGGCCCAGACTCCCCCACCATGG - Intergenic
1182429534 22:30291675-30291697 TGGTCCTCACCCACCCACCAAGG - Intronic
1183364380 22:37399488-37399510 TCTCCCACCTCCACCGACCACGG + Intronic
1183364394 22:37399527-37399549 TCTCCCACCTCCACCGACCACGG + Intronic
1183364409 22:37399566-37399588 TCTCCCACCTCCACCGACCACGG + Intronic
1183364423 22:37399605-37399627 TCTCCCACCTCCACCGACCACGG + Intronic
1183364437 22:37399644-37399666 TCTCCCACCTCCACCGACCACGG + Intronic
1183384852 22:37508994-37509016 TGGCCCTCACCCACCATCCAGGG + Intronic
1183581776 22:38730714-38730736 TGGCCCACCCTCACCACCCAAGG + Exonic
1183628747 22:39020707-39020729 CGGCCCCCACCCAGCGGCCATGG - Intronic
1183632224 22:39040466-39040488 CGGCCCCCACCCAGCGGCCATGG - Intergenic
1183638046 22:39076867-39076889 CGGCCCCCACCCAGCGGCCATGG - Intronic
1184225686 22:43127837-43127859 GGGCCTCCACCCACCGCCCAGGG - Intronic
951647017 3:24904123-24904145 TGGCTCTCACTCACCAACCAGGG + Intergenic
953108824 3:39912162-39912184 AGGCCCACACCCACCGATAGAGG - Intronic
953661386 3:44894070-44894092 TGGCCCTCTCCCACCTCCCATGG + Intronic
956588347 3:70887287-70887309 TGGCCCTGACCCTCAGACCACGG - Intergenic
961018758 3:123486672-123486694 TGGCCCCCACCAGCCGAGCATGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
968462045 4:731114-731136 AGGCCCACGCCCCCCGACCCCGG + Intronic
975723663 4:77271766-77271788 TGCCCCAAACCCACCCATCATGG - Intronic
989455377 5:41637673-41637695 TAGCCCCCGCCCACAGACCACGG + Intergenic
990289503 5:54334194-54334216 TTGCCCACACTCACCATCCAGGG + Intergenic
997400248 5:133596666-133596688 TAGCCCGGTCCCACCGACCAAGG + Intronic
998279988 5:140796708-140796730 TGCCCTGCACCCACCGACCACGG - Exonic
998280561 5:140802941-140802963 TGGCCCGCACCCACTGACCGCGG - Exonic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
998282332 5:140823516-140823538 TGGCCCGCACCCACTGACCTCGG - Exonic
998283578 5:140836127-140836149 TGGCCCGCGCCCACAGACCGCGG - Exonic
998284263 5:140843065-140843087 TGGCCCGCGCCCACAGACCGCGG - Exonic
998286853 5:140870844-140870866 TGGCCCGCACCCACCGACCGCGG - Exonic
998287493 5:140877216-140877238 TGGCCCGCACCCACCGACCGCGG - Exonic
998288163 5:140884012-140884034 TGGCCTGCACCCACCGACCGCGG - Exonic
1006359357 6:33578873-33578895 AGCCCCACCCCCACCGCCCAGGG + Intronic
1009640513 6:66329396-66329418 TTCCCCTCACCCACCAACCAAGG + Intergenic
1017885024 6:158591796-158591818 CGGCCCACACCCATAGAACAGGG - Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1022100899 7:27168652-27168674 AGGCCCAAACCCACCGCCCTCGG + Intronic
1023864540 7:44232565-44232587 TGGCCGACACTCTCAGACCAGGG - Intronic
1026275350 7:68871466-68871488 TGGACTCCACCCACCGTCCAAGG - Intergenic
1028510421 7:91619483-91619505 TGGCCCAAAGCCACTGACCATGG - Intergenic
1031754324 7:125618643-125618665 TGCTCCACACCCACCAGCCAAGG - Intergenic
1032421662 7:131785035-131785057 TAGCCCACACCCACATACTAGGG + Intergenic
1035637149 8:1155754-1155776 CGTCCCAGCCCCACCGACCAAGG - Intergenic
1035657975 8:1325389-1325411 GGGACCACACCCAGGGACCAGGG - Intergenic
1036824179 8:11963616-11963638 AGGCCCTCACCCACAGAGCACGG - Intergenic
1042484711 8:69337084-69337106 AGGGCCACACCCACCCACCCTGG - Intergenic
1048809958 8:138276726-138276748 GGGCACACACCCACACACCAGGG + Intronic
1049572581 8:143376188-143376210 TGGCTCTCACCCACCATCCAAGG + Intronic
1051896815 9:21995913-21995935 TGGCACACACCCACCCACTCAGG - Intronic
1052516477 9:29487033-29487055 TGTCCCCCACCCACAGGCCATGG - Intergenic
1053064278 9:35056704-35056726 TGGCCCCTACCCACCTACCCAGG + Exonic
1057791315 9:98126970-98126992 AGGCCCAAACCCACAGAGCAGGG + Intronic
1062207951 9:135347493-135347515 TGGGCCAGACCCGCCCACCAAGG + Intergenic
1062360600 9:136186222-136186244 TAGCCCACACCCCCCTCCCAGGG + Intergenic
1062422313 9:136488731-136488753 TGGCCCTCACCCCACGCCCAGGG - Intergenic
1062429127 9:136519210-136519232 CGGCCCACACAGACCAACCAGGG + Intronic
1189294039 X:39906172-39906194 TGGCCCTCACCCGCTGACCTGGG - Intergenic
1198658736 X:138943218-138943240 TGGCTCACTCCCACTGCCCATGG + Intronic
1200074470 X:153544296-153544318 TGGCCCTCTCCCATCGTCCACGG + Intronic
1200691254 Y:6307515-6307537 TGGACCACTCCCACAGACCCAGG - Intergenic
1201044018 Y:9867201-9867223 TGGACCACTCCCACAGACCCAGG + Intergenic