ID: 998282366

View in Genome Browser
Species Human (GRCh38)
Location 5:140823743-140823765
Sequence CTGTGGCTGTGGCTGTCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 3, 2: 8, 3: 50, 4: 444}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998282366_998282378 28 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282378 5:140823794-140823816 GGCGCCGAAGGCCTCATCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 36
998282366_998282373 2 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282373 5:140823768-140823790 CTGGTGTCGCTGGTGGAAAGTGG 0: 2
1: 4
2: 5
3: 16
4: 153
998282366_998282372 -5 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282372 5:140823761-140823783 CACAGTGCTGGTGTCGCTGGTGG 0: 1
1: 4
2: 4
3: 22
4: 185
998282366_998282375 16 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282375 5:140823782-140823804 GGAAAGTGGCCAGGCGCCGAAGG 0: 1
1: 0
2: 1
3: 16
4: 112
998282366_998282374 7 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282374 5:140823773-140823795 GTCGCTGGTGGAAAGTGGCCAGG 0: 1
1: 4
2: 2
3: 12
4: 202
998282366_998282370 -8 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282370 5:140823758-140823780 AGCCACAGTGCTGGTGTCGCTGG 0: 1
1: 1
2: 4
3: 20
4: 178
998282366_998282377 27 Left 998282366 5:140823743-140823765 CCCGCTGACAGCCACAGCCACAG 0: 1
1: 3
2: 8
3: 50
4: 444
Right 998282377 5:140823793-140823815 AGGCGCCGAAGGCCTCATCGCGG 0: 1
1: 0
2: 0
3: 7
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998282366 Original CRISPR CTGTGGCTGTGGCTGTCAGC GGG (reversed) Exonic
901228548 1:7629257-7629279 CTGGGGCTGCGAGTGTCAGCTGG - Intronic
902512401 1:16973535-16973557 CTGTGGCTGAATCGGTCAGCTGG - Intergenic
902784505 1:18724294-18724316 CAGTGGCTAAGGCTGGCAGCAGG + Intronic
903386964 1:22933298-22933320 CTCTGGCTGTGGCCTCCAGCTGG - Intergenic
903405479 1:23091842-23091864 CTGGGGCTGCTGCTGTCAGATGG + Exonic
903911694 1:26731450-26731472 CTGAGCCTGTGGCTGTGAGTAGG - Exonic
903949456 1:26987109-26987131 CTGTGGCTGTGGCCCCAAGCAGG - Intergenic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904437276 1:30506991-30507013 CTGTTGCTCAGGTTGTCAGCTGG + Intergenic
904526314 1:31136418-31136440 CAGTGGAAGTGGCTCTCAGCGGG - Intergenic
905106029 1:35564142-35564164 CTATGCCTGTGCCTGTGAGCAGG - Intronic
905210850 1:36373202-36373224 CTGTGGCTGGCGGTGTCACCAGG + Intronic
905895200 1:41541201-41541223 CTATGGCTGTGGCTGTGGGATGG + Intronic
906072191 1:43025130-43025152 GAGTGGTTCTGGCTGTCAGCAGG + Intergenic
906155380 1:43611103-43611125 GCCTTGCTGTGGCTGTCAGCTGG + Intronic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
906525016 1:46488874-46488896 CTGTGGATGTGGCTGTGTGGAGG - Intergenic
908766382 1:67558477-67558499 GTGTGGCTGAGGCTGTCTTCAGG - Intergenic
911116070 1:94247680-94247702 CTGTGGCTGCGGCTGCCACTTGG - Intronic
912879398 1:113393260-113393282 CAGTGTCTGTGGCTGTCAAGAGG - Intronic
915283172 1:154836545-154836567 CTGTGGCTGGGAGTCTCAGCTGG + Intronic
916436478 1:164782343-164782365 CTCTGTCTATGGCTGTCACCTGG + Intronic
916840685 1:168597475-168597497 CTGTTGCTGTGGGAGCCAGCTGG + Intergenic
917459721 1:175219490-175219512 GTGTGTCTGGGGCTGTCAGAGGG - Intergenic
917521128 1:175749294-175749316 CTGTCTCTGTGGCAGGCAGCTGG - Intergenic
917790730 1:178497115-178497137 CAGTGTCTGTCGCTGCCAGCAGG + Intergenic
917836159 1:178943081-178943103 CTGTGGCTCTGCCAATCAGCCGG + Intergenic
918238274 1:182600450-182600472 ATGTGGCTGTGGCAGTCTGCAGG + Exonic
919709345 1:200710639-200710661 ATGTGGCCGTGGGTTTCAGCAGG + Intergenic
919817102 1:201448528-201448550 CTGTGGCTCAGGCTGGAAGCTGG - Intergenic
920288513 1:204899388-204899410 CTGGGGCTGAGGCCGGCAGCTGG + Intronic
920325415 1:205159506-205159528 CCGTGGATTTGGCTGCCAGCTGG + Intronic
920942422 1:210496247-210496269 CTATGCCTGTGGCTGTTGGCAGG + Intronic
921053017 1:211524595-211524617 CTGTGCCGGTGGCAGGCAGCTGG + Intergenic
922470401 1:225873472-225873494 CTGGGGCTCTGGGTGGCAGCTGG + Intronic
922590454 1:226771937-226771959 CTGAGCCCGTGACTGTCAGCAGG + Intergenic
922722157 1:227904671-227904693 CTGTGCCTGAGGCTCACAGCAGG - Intergenic
923050973 1:230391187-230391209 CTGTCGCTGTGGCTGACATCTGG + Intronic
923975472 1:239257292-239257314 TGGTGGAGGTGGCTGTCAGCAGG + Intergenic
924172741 1:241358121-241358143 CTGTGCCTCTGGCTTTCAGGGGG + Intergenic
1062808250 10:441365-441387 CTGTGACCGTGGCTGTGAGTTGG - Intronic
1062928745 10:1338680-1338702 CTAAGGCTGGGGCTGTGAGCTGG - Intronic
1062987033 10:1778751-1778773 CTGTGGCTCTCGCTGTGTGCTGG + Intergenic
1063057431 10:2521090-2521112 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057455 10:2521202-2521224 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057467 10:2521258-2521280 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057624 10:2521866-2521888 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057956 10:2523202-2523224 GTGTGGCTGTGGGTGTCGCCTGG - Intergenic
1063057967 10:2523252-2523274 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057974 10:2523280-2523302 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057986 10:2523330-2523352 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057993 10:2523358-2523380 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063058008 10:2523413-2523435 GTGTGGATGTGGGTGTCACCCGG - Intergenic
1063625259 10:7683307-7683329 TTCTTGCTTTGGCTGTCAGCTGG - Intergenic
1063729595 10:8680868-8680890 CTGTGCCTGGTGATGTCAGCTGG + Intergenic
1067320035 10:45209484-45209506 TTGTAGCTGTGGGTGTCAGAGGG - Intergenic
1067792370 10:49298084-49298106 CTGTGGCCCTGGCTGTCAGCCGG + Intergenic
1068083487 10:52347287-52347309 ATGTGGCTGGGGCTGCCTGCAGG + Intergenic
1069853321 10:71424563-71424585 CTGAGGGTGTGCCTGGCAGCTGG + Intronic
1070366847 10:75744944-75744966 CTGTGCCTGTGCATGTCAGCAGG - Intronic
1070816311 10:79325892-79325914 GTGTGTCTGTGTGTGTCAGCAGG + Intergenic
1071174494 10:82908848-82908870 CTGGAGCTGTGGCAGTCAGGAGG + Intronic
1071174506 10:82908923-82908945 CTGGAGCTGTGGCAGTCAGGAGG + Intronic
1072172665 10:92881131-92881153 CAGTTGCTGTGGCTGTCATTTGG + Intronic
1073765854 10:106682235-106682257 CTGTTGCTATGGCTTTCAGAGGG + Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1074886893 10:117700928-117700950 CAGTTGCTGTGGCTTTCAGAGGG + Intergenic
1075035137 10:119059256-119059278 CTGAGGACATGGCTGTCAGCTGG + Exonic
1075357162 10:121790087-121790109 GTGTGGCTGTGGCTCTTAACAGG - Intronic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075736268 10:124666427-124666449 CTGTGGATGGGGCTTGCAGCTGG + Intronic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1075833106 10:125427969-125427991 CTGTGGCTGAGGCCGTCTTCAGG + Intergenic
1076129354 10:128002147-128002169 CATAGGCTCTGGCTGTCAGCGGG - Intronic
1076344201 10:129769222-129769244 CTGCTGCTGCGGCTGTCAGAGGG - Intergenic
1076469601 10:130709318-130709340 CTGTGCCTGCTGCTGTCAGGTGG - Intergenic
1076922256 10:133460095-133460117 CTGTGGCAGTGCCCGTCGGCGGG + Intergenic
1077113118 11:870565-870587 CAAAGGCTGTGGCTCTCAGCAGG + Intronic
1077282978 11:1753951-1753973 CTGGGGCTGGGGCTGGCAGGGGG - Intronic
1077465246 11:2730860-2730882 CTGTGGCTGTGGCCAGAAGCAGG + Intronic
1077580969 11:3417088-3417110 TGCAGGCTGTGGCTGTCAGCAGG + Intergenic
1078070016 11:8102247-8102269 CTGTGGCTATGGGAATCAGCTGG + Exonic
1078158034 11:8815468-8815490 CTGTGGTTGTGCCTGTAATCGGG - Intronic
1078792799 11:14561459-14561481 CTTTGGCTTTTGCAGTCAGCTGG + Intronic
1079339204 11:19598098-19598120 CTGTGCCTGTCACTGTCAGGGGG - Intronic
1079987950 11:27218052-27218074 CTGTGGCTGTGCATGGCAGCTGG - Intergenic
1080321413 11:31014373-31014395 ATGTGACTGTGGCTGTTGGCAGG - Intronic
1081739306 11:45426995-45427017 CTGTGGTTGAGGCTGACAGCGGG + Intergenic
1081968272 11:47182605-47182627 TTGGGGCTGGGGCTGTCAGATGG + Intronic
1082699042 11:56404759-56404781 CTTTTGGTGAGGCTGTCAGCTGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083812473 11:65113252-65113274 GTGGGGCTGGGGATGTCAGCGGG + Exonic
1083852882 11:65378190-65378212 CTGTGGGGGTGTCTGTCACCTGG - Intronic
1084237896 11:67799923-67799945 TGCAGGCTGTGGCTGTCAGCAGG + Intergenic
1084308622 11:68302762-68302784 CTGTGGCTGCAGCTGTCTGGCGG + Intergenic
1084566471 11:69931562-69931584 CTGCGGCTAGGGCTGTCAGATGG - Intergenic
1084603776 11:70161262-70161284 CGGTGGCTGTGACTGTGACCCGG - Exonic
1084634686 11:70383735-70383757 CAGTGGCTGAGACTGTGAGCTGG + Exonic
1084834512 11:71792911-71792933 TGCAGGCTGTGGCTGTCAGCAGG - Intronic
1085123583 11:73982748-73982770 GTGCGGCTGTGTCTGTCGGCTGG + Exonic
1085514565 11:77104836-77104858 CTGTGGCTGGGGCTGCCGGGAGG + Intronic
1086498849 11:87431648-87431670 CTGGGGCTGCAGCTGTGAGCAGG + Intergenic
1088795653 11:113264894-113264916 CTGGGGCTGCAGCTGTCACCAGG - Intronic
1089098526 11:115939904-115939926 ATGTGGCTGGGGGTGTCAGCTGG + Intergenic
1089452807 11:118609184-118609206 CTGGGGCTGTGTGTGTGAGCTGG - Intronic
1089452816 11:118609273-118609295 CTGGGGCTGTGTGTGTGAGCTGG - Intronic
1090644113 11:128753744-128753766 ATGTGGCTGCTGCTGTCTGCAGG - Intronic
1091447183 12:550779-550801 CTGTGGCTGAGGCTGCCAGCTGG - Intronic
1091563018 12:1629222-1629244 CTGTGGCTGTGACTGCCCCCAGG - Exonic
1091753281 12:3035911-3035933 CTGTGGCTGTGACTGGCCGAAGG - Intronic
1092071523 12:5635230-5635252 CTGTTGCTGTCACTGTCACCCGG + Exonic
1092214527 12:6671890-6671912 TTGTTGCTGTGGGTGTCACCAGG + Intronic
1092408571 12:8237551-8237573 TGCAGGCTGTGGCTGTCAGCAGG + Intergenic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093098443 12:14998822-14998844 ATGTGGAGGTGGCTGTCAGATGG + Intergenic
1094526650 12:31235492-31235514 CAGTGGCTCTGGCTGTCCACTGG + Intergenic
1095998229 12:48107080-48107102 CTGTGCCTGTGGCTGTGATCTGG - Intronic
1096651351 12:53063470-53063492 CTGGGGCTGGGGCTGGGAGCTGG - Intronic
1096845286 12:54403230-54403252 CTGAGGCCGTGGCTGTCCACTGG + Exonic
1097188495 12:57208446-57208468 GTGTGGCTGTGCATGACAGCCGG - Intronic
1097881177 12:64687955-64687977 CTGATGCTGTGGCTGACTGCCGG - Intronic
1100853764 12:98740139-98740161 GTGTGGCTTTGGCTGTCAAGTGG + Intronic
1102555604 12:113724680-113724702 CTGTGGCTGTGACAGTCTTCTGG - Intergenic
1103140491 12:118543780-118543802 CTGTGGCTGTTGGGGACAGCAGG + Intergenic
1103238040 12:119390439-119390461 CTGGGGCTGTGACTGTAAACAGG - Intronic
1103917063 12:124381217-124381239 CTGTGGCTGGGGCAGCGAGCAGG - Intronic
1104019778 12:124984165-124984187 CTGTAGCAGTGACTGTCATCCGG - Intronic
1104872735 12:132011951-132011973 CTGTGCCTGTGGAAGCCAGCAGG - Intronic
1105733723 13:23246347-23246369 CTGTTGCTTTGGCTGCCAGAGGG - Intronic
1107295195 13:38900387-38900409 CTATGGCTGGAGCTGTCAGACGG + Intergenic
1107346039 13:39461984-39462006 CTGTGGCTGAGTCTGTCACCTGG + Intronic
1107570897 13:41657132-41657154 CTTTGGCTGAGGTTGCCAGCTGG + Intronic
1107634740 13:42380926-42380948 CGGAGGCTGAGGCTCTCAGCTGG + Intergenic
1112390164 13:98975980-98976002 CTGTGGCTGTTGCTGCCCACTGG - Intronic
1113190186 13:107736392-107736414 CTGTTGCTGCTGCTGTCAGTAGG + Intronic
1113413929 13:110113465-110113487 CTGTGGCCCTGGCTGACATCCGG - Intergenic
1113584247 13:111452515-111452537 ATGTGTCGGTGGCTGCCAGCTGG - Intergenic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1116718474 14:48460056-48460078 CTGTGAGTGTAGCTGTGAGCTGG - Intergenic
1116820433 14:49621444-49621466 CTGTGGCTGTGGGCATCCGCAGG + Exonic
1118112295 14:62735264-62735286 CTGAAGCTGTAGCTGTCATCAGG + Intronic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119433226 14:74581893-74581915 CTGTGGTGGTGGCTTCCAGCAGG - Intronic
1119913539 14:78373569-78373591 ATGTGGCTGTGGGTGTCTCCTGG + Intronic
1120816466 14:88864544-88864566 CTGTTGCTGTGGCTGTGATACGG + Intronic
1121530288 14:94647973-94647995 CTGTGACTTTGGCTGTCAGCTGG + Intergenic
1121940541 14:98066269-98066291 CTGAGGCTGTGTCTGTGAGGTGG - Intergenic
1122070057 14:99200429-99200451 CTGTGCCTGTGCCTGTGATCTGG - Intronic
1122238442 14:100345940-100345962 CTGTGGCTCTGGCTCCAAGCAGG + Intronic
1122288690 14:100667954-100667976 CTGTGGCAGTGCCAGGCAGCTGG + Intergenic
1122651868 14:103230787-103230809 CCTTGGCTGTGGCTGTGACCTGG - Intergenic
1122830524 14:104393460-104393482 TTGGGTCTGTGGCTCTCAGCAGG - Intergenic
1122842296 14:104472359-104472381 CTGTGTGTGTGGCTGTGTGCAGG - Intergenic
1122960642 14:105092390-105092412 CTGAGGGGGTAGCTGTCAGCCGG - Intergenic
1123031288 14:105452715-105452737 CTGAGGCTGAGGCTGGCAGCTGG + Intronic
1123466693 15:20522003-20522025 CAGTGGCTGCAGCTCTCAGCTGG + Intergenic
1123651420 15:22479038-22479060 CAGTGGCTGCAGCTCTCAGCTGG - Intergenic
1123713091 15:23005187-23005209 CTGTGGCTGTGCCTGTCCCCAGG + Intronic
1123741838 15:23287899-23287921 CAGTGGCTGCAGCTCTCAGCTGG - Intergenic
1123745158 15:23314659-23314681 CAGTGGCTGCAGCTCTCAGCTGG + Intergenic
1123761479 15:23436585-23436607 CAGTGGCTGCAGCTCTCAGCTGG + Intergenic
1124277430 15:28337979-28338001 CAGTGGCTGCAGCTCTCAGCTGG + Intergenic
1124305271 15:28573627-28573649 CAGTGGCTGCAGCTCTCAGCTGG - Intergenic
1124427373 15:29572938-29572960 CAGAGGCTGTTACTGTCAGCTGG + Intergenic
1124860697 15:33437634-33437656 CTGTGGCAGAGACTGTAAGCTGG - Intronic
1126422082 15:48485410-48485432 CTATGAATGTAGCTGTCAGCCGG - Exonic
1126480179 15:49110568-49110590 CAGTGGCAGTGGCTGTAGGCAGG - Intronic
1127261587 15:57330476-57330498 CTGTCCCTATGGCTGTCAGTGGG + Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1128155540 15:65389487-65389509 CTGGGGCTGGGGCTGACTGCAGG - Intronic
1128389369 15:67172893-67172915 CTGTGGCTGTGGCTCCCGGGGGG + Intronic
1128513171 15:68326132-68326154 CTGGGGCTGGAGCTGTGAGCTGG + Intronic
1129461028 15:75700168-75700190 TAGGGGCTGTGGGTGTCAGCAGG + Intronic
1129723792 15:77891557-77891579 TAGGGGCTGTGGGTGTCAGCAGG - Intergenic
1130171904 15:81523460-81523482 TGGTGGAGGTGGCTGTCAGCAGG + Intergenic
1130876349 15:88018001-88018023 TTGTGGCTGGGCCTCTCAGCAGG - Intronic
1131112894 15:89776500-89776522 CTGTGGCTGCGGGAGTCCGCGGG - Exonic
1131891440 15:96976056-96976078 CTGTGGCTTTGGCTGACATGTGG + Intergenic
1132541142 16:510394-510416 CAGTGCCTGTGGGTATCAGCTGG + Intronic
1132617730 16:850535-850557 CTGTGGTTGTTGTTGTCAGAAGG + Intergenic
1132756496 16:1487836-1487858 CTGTGGCTCAGGCAGTCAACCGG - Exonic
1132866215 16:2093910-2093932 CTGTGGCTGTGGCTGTCTCAGGG - Exonic
1133339654 16:5028093-5028115 CCGTGGCCGTGGCAGTCAGGCGG + Exonic
1133349538 16:5092370-5092392 TGCAGGCTGTGGCTGTCAGCAGG + Intronic
1134332269 16:13261914-13261936 CTGTGGCTGAGGATATCAGTAGG + Intergenic
1136988587 16:35137791-35137813 CTCTGTCTGGGGCTGTCAGCAGG - Intergenic
1137554691 16:49463228-49463250 CTTTGGCTGTTGCTGGCAGTGGG - Intergenic
1138218503 16:55227164-55227186 TGGTGCCTGTGGTTGTCAGCAGG - Intergenic
1138552757 16:57756442-57756464 CTGTGGGTGTGGATATCAGCAGG + Exonic
1138730087 16:59184842-59184864 CTCTGGTTGTGGCTGTCTCCTGG + Intergenic
1139349237 16:66325014-66325036 CCCTGGCTGTGGCTGGCGGCTGG - Intergenic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1140205221 16:72927957-72927979 CAGTGGCCGTGGGTTTCAGCAGG - Intronic
1141200208 16:81891981-81892003 CTGGGGATGTGGCTGTGAACCGG + Intronic
1141807504 16:86351692-86351714 CTGGGGCTATGGCTGGGAGCTGG + Intergenic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1142234372 16:88914984-88915006 GTGGGGGTGTGGCTGCCAGCCGG + Intronic
1142276888 16:89123491-89123513 GTGAGGCTGTGGCCGACAGCTGG + Intronic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1143102102 17:4510122-4510144 CTGTGGCTGTGGCCGCCTCCAGG + Intronic
1143251306 17:5525245-5525267 CTGTGGATGTAGCTGTGAACAGG + Intronic
1143526950 17:7478738-7478760 CTGTGGCTTTGGGTGACAGATGG - Intronic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1144290943 17:13825586-13825608 CTGTGGCAATGGCTCTCAACTGG - Intergenic
1144785987 17:17831881-17831903 GTTTGGCTGTGGCAGGCAGCAGG + Intronic
1146399897 17:32494234-32494256 CAGTGGCTTTGGCTGGCGGCTGG + Exonic
1146904998 17:36612538-36612560 CTGTGGCTGTGGGTGTGAAGGGG + Intergenic
1146972784 17:37086173-37086195 CTGAGGGTGTAGCTGTCACCAGG + Exonic
1147538329 17:41335198-41335220 CAGTGGGTGTGGCTGACACCTGG + Intergenic
1149521871 17:57323732-57323754 CTGCCGCTGTGGGTGTCAACGGG + Intronic
1150461487 17:65357197-65357219 GTGTGGCTGTGGCTGTTGGGGGG + Intergenic
1151417656 17:73977086-73977108 CCGTGGCTGTGGCTCCGAGCAGG - Intergenic
1151933782 17:77248962-77248984 ATGTGGCTGTGGCTGCAATCGGG - Intergenic
1152221488 17:79070744-79070766 CTGTGGCTATGGCTGGCCTCTGG - Intergenic
1152587432 17:81195307-81195329 ACGTGACTGTGGCTGACAGCCGG - Intronic
1152626704 17:81390922-81390944 CTGAGGCTGGGGCTGGCGGCAGG - Intergenic
1152736354 17:81999224-81999246 CCTGGGCTGTGGCTGGCAGCTGG - Intronic
1153034393 18:746292-746314 CTGTTCCTGTGACTGTCAGGTGG - Intronic
1154015461 18:10612443-10612465 CCCTGTCTGTGGATGTCAGCGGG - Intergenic
1154190050 18:12223188-12223210 CCCTGTCTGTGGATGTCAGCGGG + Intergenic
1154193809 18:12251779-12251801 CTGAGGGTGTGGGTGTCAGGTGG + Intergenic
1154356730 18:13627355-13627377 CTGAGGCTGGGGCTGTGAGGTGG + Intronic
1156517814 18:37695972-37695994 CAGTGGCTGAGGCAGTCAGATGG + Intergenic
1156549807 18:38003834-38003856 GTGTGGAGGTGGCTCTCAGCAGG - Intergenic
1156613256 18:38752205-38752227 CTTTGGCTCTGGCAGGCAGCAGG + Intergenic
1157470347 18:47983532-47983554 CCGTGGCTGTGTCTGAGAGCAGG + Intergenic
1157528716 18:48404923-48404945 CTGTGGCTGTGGGTGGCACCTGG - Intronic
1157811102 18:50696616-50696638 CTGAGGCTCTGGCTTTCAGCCGG - Intronic
1159440874 18:68478444-68478466 CTGTGGCTGTTACTGACAGGTGG - Intergenic
1159613068 18:70547639-70547661 CTGTGGTGGTGGCTGGTAGCAGG + Intergenic
1160717657 19:583663-583685 CAGGGCCTGAGGCTGTCAGCCGG + Intergenic
1160837503 19:1131755-1131777 CAGTGGCAGTGGCTGTCGGGAGG - Intronic
1161339571 19:3733876-3733898 CTGTCGCTGTCACTGACAGCAGG - Exonic
1161366299 19:3881676-3881698 CTGTGGCTGCAGCTGGCAGGGGG + Intronic
1161847323 19:6719165-6719187 GCGTGGCTGTGGGTGTCAGCCGG + Intronic
1162059148 19:8084314-8084336 GTGTGTCTGTGTGTGTCAGCTGG - Intronic
1162363123 19:10231276-10231298 CTGGGGCTGGGGTTGCCAGCCGG + Intronic
1162498735 19:11038714-11038736 CTGAGGCTGTGCCAGTGAGCTGG - Intronic
1163034217 19:14562178-14562200 CTGTGGCTGTGGTTGCCACTCGG + Intronic
1163406367 19:17125658-17125680 CTGCGTCTGTGGCTGACAGTTGG + Intronic
1163580421 19:18135575-18135597 CTGTGGCAAAGGCTGTCAGTGGG + Intronic
1164609238 19:29621063-29621085 CTGTGGCTGTGGCTGGGTGCTGG - Intergenic
1165343533 19:35228687-35228709 CTGGGGCTGTGGCAGTGGGCTGG + Exonic
1165350102 19:35270484-35270506 CGGCGGCCGAGGCTGTCAGCGGG + Exonic
1165715592 19:38043924-38043946 CTCTGGCTGTGTGTGGCAGCAGG + Intronic
1165725142 19:38107399-38107421 GGGTGGGTGTGGCTGCCAGCAGG + Intronic
1167355185 19:48999312-48999334 CTTTGGTTGTGGCTGTCTGGGGG - Exonic
1167830620 19:52018453-52018475 ATGTGGCTGTGGAATTCAGCTGG - Exonic
1168543697 19:57232738-57232760 CTCTGTTTGTGGCTGTCAGGAGG + Intronic
1168666983 19:58211579-58211601 ATGTGGCTGTGGACTTCAGCCGG + Exonic
925623694 2:5820371-5820393 CTGTGTCTGTGGTTGTCTTCAGG - Intergenic
925930463 2:8703214-8703236 GGGTGGCGGTGGCTGTCAGCGGG - Intergenic
926464839 2:13175529-13175551 CAGTGGATGTGGCTTTCAGTCGG + Intergenic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
927186088 2:20483687-20483709 CTGTGGCTGAGGCTGGCTGAGGG - Intergenic
927659629 2:24981968-24981990 CTGTGGTTGTGGGTGTGAGTGGG - Intergenic
927809506 2:26173522-26173544 CTGTGCCTGTGCTTGTCCGCGGG - Intronic
928133088 2:28667423-28667445 CTGTGTCTGTACCTGTCAACAGG - Intergenic
930016886 2:46976819-46976841 CTAGAGCAGTGGCTGTCAGCAGG - Intronic
930277656 2:49332199-49332221 CTGAGGCTGTGGTTCTCAACTGG + Intergenic
930613648 2:53571004-53571026 CTGTGGCTGAGGCTGGCATGTGG - Intronic
931567658 2:63631837-63631859 CAGAGTCTGTGGCTGTCATCAGG - Intronic
931746143 2:65293551-65293573 CTGCGGCTGTGGAGTTCAGCAGG + Intergenic
932099093 2:68880221-68880243 CTTTTGCTTTGGCTGTAAGCAGG - Intergenic
932844438 2:75120716-75120738 TGGTGGCTGTGGCTGACAGCCGG + Exonic
933462910 2:82612172-82612194 CAGTGGAAGTGGCTCTCAGCAGG - Intergenic
935365771 2:102289305-102289327 CTGTGGCTCTGGCCACCAGCTGG + Intergenic
936152070 2:110027473-110027495 CTGTGGCTGTGGCTGGGCACAGG + Intergenic
936192608 2:110343940-110343962 CTGTGGCTGTGGCTGGGCACAGG - Intergenic
936669627 2:114642050-114642072 CTGTGTCTGAGGTTATCAGCAGG - Intronic
937001023 2:118467733-118467755 CTCTGGCTCTGTCTGTCACCTGG - Intergenic
937076538 2:119111452-119111474 CTGTGCCTGTTGCTGTCTACTGG - Intergenic
937224163 2:120358649-120358671 CTGAGGCTGAGGGGGTCAGCAGG + Intergenic
937484432 2:122299674-122299696 GTGAGGCTGTGTTTGTCAGCTGG - Intergenic
937910212 2:127072022-127072044 CTGAGGCTTGGGCTGGCAGCAGG - Intronic
938260423 2:129891946-129891968 CTGAGGCTGAGGCTGAGAGCGGG - Intergenic
938562789 2:132489410-132489432 CTGTGACTGGGGCTGGCGGCAGG + Intronic
939038078 2:137156869-137156891 TTGTGGCAGCAGCTGTCAGCTGG + Intronic
939510036 2:143093783-143093805 CTGTTGCTGTGGTTGTGAGTAGG + Intronic
939512917 2:143128714-143128736 CTGTGACTGTGGCTCTCATACGG - Intronic
942105512 2:172629549-172629571 TGGTGGCAGTGGCTCTCAGCGGG - Intergenic
943078291 2:183225242-183225264 CTGTGTCTGTATTTGTCAGCTGG + Intergenic
943783028 2:191846072-191846094 CTCTGGCTGCAGCTGTTAGCTGG - Intronic
944584316 2:201160176-201160198 CTGTGCCTGTGGCTGGCATCAGG + Intronic
945397777 2:209341524-209341546 CTGAGGCAGGGGCTGTCAGGGGG - Intergenic
947199154 2:227599186-227599208 ATGTGGCTGTGGCTGTGGGAAGG + Intergenic
947200982 2:227614585-227614607 ATGTGGCTGTGGCTGTAGGAAGG - Intronic
947212921 2:227724505-227724527 CTGCGGCTGTGGCTGTGGGAAGG - Intergenic
947746242 2:232508679-232508701 CTGTGGGTGTGTGTGTGAGCTGG - Intergenic
1169011661 20:2256204-2256226 ATGCTGCTGTGGCTGCCAGCTGG - Intergenic
1170547712 20:17449257-17449279 CTGTGGGTGGGGCTGTCTGCTGG - Intronic
1171262847 20:23748466-23748488 CTGTGGCTGTGGCTGCATGCAGG + Intronic
1172132461 20:32664746-32664768 CTGCAGATGTGGCTGACAGCAGG + Intergenic
1172863721 20:38078236-38078258 ATGTGGCTGAGGAAGTCAGCAGG - Intronic
1173003106 20:39119608-39119630 CAGTGACTGTGGCTGGCAGCGGG + Intergenic
1173949772 20:46981381-46981403 CTGTAGCTGTAGCTGACAGCAGG + Intronic
1174049998 20:47760865-47760887 CAGTGGCTCTGGCTGTCATGAGG - Intronic
1174358673 20:50014804-50014826 GTGTGGCTGTGTGTGTGAGCAGG + Intergenic
1174419551 20:50390757-50390779 CTGTGGAAGCGGTTGTCAGCAGG + Intergenic
1174593921 20:51668237-51668259 AAGGGGCAGTGGCTGTCAGCTGG + Intronic
1174657894 20:52186934-52186956 CTGCGGATGTGCCTGTCAGCTGG + Exonic
1174886840 20:54345033-54345055 CTGTGCCTGTGGCTTCCAGTGGG + Intergenic
1175224162 20:57435114-57435136 CAGTGCCTGGTGCTGTCAGCTGG - Intergenic
1175723072 20:61299275-61299297 CTGGGGCTGTGGCAGTCCCCGGG - Intronic
1175897294 20:62344426-62344448 CTGTGGCTGTGACTGTATGCTGG + Intronic
1175975127 20:62707300-62707322 CTGAGCCGGTGGCTGGCAGCGGG - Intergenic
1176063133 20:63180895-63180917 CTGTGGCTGCGGGTGTGAGCAGG - Intergenic
1176074915 20:63244054-63244076 CTTTGTCTGTGGCTGCCAGGTGG - Exonic
1177363655 21:20105102-20105124 CAGCGGAAGTGGCTGTCAGCGGG - Intergenic
1177647453 21:23917723-23917745 TTGTGGAGGTGGCTCTCAGCAGG - Intergenic
1178417490 21:32415539-32415561 CTTTTCCTGGGGCTGTCAGCTGG + Intronic
1178831389 21:36059979-36060001 CTGTGTCTGTGGCGGTCACCGGG - Exonic
1179358142 21:40681355-40681377 CTGGTGGTGTGGCTGCCAGCTGG + Intronic
1179496638 21:41775957-41775979 CCGTGGCTGTGGGTCTCACCAGG - Intergenic
1180138572 21:45876983-45877005 CTGTGAGTGCGGCTGGCAGCAGG - Intronic
1180611084 22:17098442-17098464 ACGAGGTTGTGGCTGTCAGCAGG - Intronic
1180613929 22:17115395-17115417 CTGTGGCTTTGGCCATCAACTGG - Exonic
1180649969 22:17369548-17369570 CTGCGGCTGCGGCTGCCCGCGGG - Exonic
1180717455 22:17881482-17881504 CTGTGGCTGTGCCTATCAGAAGG - Intronic
1180737329 22:18027120-18027142 CTGAGGCTGAGGCCATCAGCAGG - Intergenic
1180857601 22:19058274-19058296 CTGTTGCTGTGGCTGCCTGCTGG - Intronic
1180858314 22:19062197-19062219 ATGTGGCTGGGGCTCTCAGGAGG + Intronic
1181023023 22:20113360-20113382 CTGTGGCTGAGGCTTGCAGCAGG + Intronic
1181306714 22:21921258-21921280 CTGGGGCTCTCGCTGTCTGCAGG + Exonic
1182257239 22:29048176-29048198 CTGTGGATGGGGCTGACTGCTGG + Intronic
1182454324 22:30440117-30440139 GTGCGGCTCTGGCAGTCAGCAGG + Intergenic
1182460313 22:30478893-30478915 CAGTGGAAGTGGCTCTCAGCAGG - Intergenic
1182925231 22:34116224-34116246 CAGGGGCTGTGGCTGGCAACTGG - Intergenic
1183108187 22:35629516-35629538 CGGTGCCTGTGGCTGTGATCTGG - Intronic
1183369791 22:37426046-37426068 CTGCGGCTGTCGCTATCAGCAGG - Intronic
1183389768 22:37538922-37538944 CTCTGTAAGTGGCTGTCAGCAGG + Intergenic
1183945845 22:41325260-41325282 CTGGGGCTGTGGCTGGAAGTGGG + Intronic
1183987102 22:41575899-41575921 GTGTGGCTGTTGCTGTCACCTGG + Exonic
1184390562 22:44200992-44201014 CTGTGGCTGTGGCTGGGAGTCGG - Intronic
1184390563 22:44200998-44201020 CTGTGGCTGTGGCTGTGGCTGGG - Intronic
1184607529 22:45582580-45582602 GTGCGGCTGTGGCTGTCACTGGG - Intronic
1185151161 22:49164691-49164713 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
1185151196 22:49164777-49164799 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
949359987 3:3221488-3221510 CTGAGGCTGGGGCTGACTGCAGG + Intergenic
950089228 3:10283590-10283612 CTGTGGCGTTGGCTGTGAGTCGG + Intronic
953570208 3:44065439-44065461 CTGTGGCGGTGGCTGGCTCCGGG + Intergenic
954459061 3:50616244-50616266 GGGTGGCTGTGGCTGTCTTCTGG - Intronic
957053841 3:75429716-75429738 TGCAGGCTGTGGCTGTCAGCAGG + Intergenic
957735513 3:84197060-84197082 CAGTGGCTGCAGCTGTAAGCAGG + Intergenic
957863334 3:85989118-85989140 CTGTTACTCTGGATGTCAGCAGG + Intronic
958948115 3:100387571-100387593 CTGTGTCTGTGTCTTTTAGCTGG - Intronic
959694192 3:109231896-109231918 CAGTGGAAGTGGCTCTCAGCAGG - Intergenic
960521718 3:118662697-118662719 CAGTGGCTGTGGCGTACAGCTGG + Intergenic
960845116 3:121997707-121997729 CTGTGGCTGTGGCCTACTGCTGG + Intronic
961273041 3:125704088-125704110 CTCAGCCTGTGGCTGTCACCTGG + Intergenic
961301007 3:125921995-125922017 TGCAGGCTGTGGCTGTCAGCAGG - Intergenic
961808636 3:129507607-129507629 CAGTGTCTGTGGCTGCCAACTGG - Intronic
961887519 3:130106102-130106124 TGCAGGCTGTGGCTGTCAGCAGG + Intronic
962292520 3:134148459-134148481 CTGTTTCTCTGGCTATCAGCTGG - Intronic
963837294 3:150070206-150070228 CGGTGGCTGTGCCTGGCAGTAGG - Intergenic
965486994 3:169290556-169290578 CTGTGTATGTGGCTGTCACTGGG - Intronic
965801631 3:172499727-172499749 TAGTGGCTGTGGGGGTCAGCGGG - Intergenic
968427909 4:535358-535380 TCGTGACTGTGGCTGGCAGCAGG - Intronic
968611957 4:1561255-1561277 CTGTGGCTGTGCCTGCCCTCTGG - Intergenic
968634491 4:1670956-1670978 CCGTGGCTGTGGCTGTGAGCTGG - Intronic
968634511 4:1671062-1671084 CCGTGGCTGTGGCTGTGAGCTGG - Intronic
968634522 4:1671118-1671140 CCATGGCTGTGGCTGTGAGCTGG - Intronic
968634545 4:1671224-1671246 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968634555 4:1671280-1671302 CCGTGGCTGTGGCTGTGAGCTGG - Intronic
968634588 4:1671436-1671458 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968634600 4:1671492-1671514 CCGTGGCTGTGGCTGTGAGCTGG - Intronic
968634611 4:1671548-1671570 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968652730 4:1766639-1766661 CTGTGGCTGTGGCTGAGCGCGGG - Intergenic
968893168 4:3383181-3383203 CTGTGGCTGAGGCTCACTGCGGG + Intronic
968996642 4:3950023-3950045 TGCAGGCTGTGGCTGTCAGCAGG + Intergenic
969362175 4:6671970-6671992 CTGGGGCTTTGGCTGTAAGTTGG - Intergenic
969402798 4:6968061-6968083 CTTAGGCTGTGGGTCTCAGCCGG + Intronic
969757356 4:9158653-9158675 TGCAGGCTGTGGCTGTCAGCAGG - Intergenic
969817316 4:9696220-9696242 TGCAGGCTGTGGCTGTCAGCAGG - Intergenic
971453253 4:26819539-26819561 CTGTGGCTGTTGCCATCATCTGG - Intergenic
972924874 4:43991395-43991417 CTGTCTGTGTGACTGTCAGCAGG + Intergenic
973066167 4:45795892-45795914 CTGTCTGTGTGGCTGTCAGCAGG + Intergenic
973840587 4:54856320-54856342 CTGTGGTTGTGTCTGTGTGCAGG - Intergenic
974025796 4:56732184-56732206 CTGGGTCTGAGGCTGGCAGCAGG - Intergenic
974344597 4:60662490-60662512 CAGTGGAAGTGGCTCTCAGCAGG + Intergenic
975246984 4:72130938-72130960 CGGTGGAAGTGGCTCTCAGCAGG + Intronic
976620610 4:87123374-87123396 CTGTGGCTGCAGCTGCCAGATGG + Intronic
976859078 4:89641015-89641037 TTGTGGAGGTGGCTCTCAGCGGG - Intergenic
977357853 4:95969346-95969368 CAGTGGAAGTGGCTCTCAGCAGG - Intergenic
978334221 4:107648503-107648525 CTGGGGCTCTGGCTGTGGGCTGG - Intronic
978398852 4:108310438-108310460 CGGTGGAAGTGGCTCTCAGCAGG - Intergenic
979727596 4:123982819-123982841 GTGTGGAGGTGGCTCTCAGCAGG + Intergenic
981518300 4:145634328-145634350 CTGTGGCAGTGGCAGTCATGGGG - Intronic
984166552 4:176309276-176309298 CTGCAGCTGTGACTGTCACCTGG - Intergenic
986587638 5:9335335-9335357 TTCTGGCTGTGGATGGCAGCTGG - Intronic
986643665 5:9895457-9895479 CTGTGGCTGAGCCGGGCAGCAGG + Intergenic
986726869 5:10605004-10605026 CTGTGGCTGTAGTTGTCTGAAGG + Intronic
986824360 5:11504748-11504770 CTCAGGCAGTGGCTGTCAGATGG - Intronic
986873719 5:12081067-12081089 CCATGGCAGTGGCTGTGAGCAGG - Intergenic
990347208 5:54882968-54882990 CTGTGACTGTGGCTTTGAGGGGG - Intergenic
991633964 5:68684468-68684490 CTGTGGCTGTGACTTGTAGCAGG - Intergenic
991963118 5:72065348-72065370 CTGTGGCTGGGTGTGGCAGCAGG + Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
992431627 5:76716120-76716142 CTGTGTCTGGGGCGGTTAGCGGG - Exonic
993047248 5:82881312-82881334 CTGTGCCAGTGGCAGTGAGCAGG + Intergenic
997253596 5:132410563-132410585 TTGGGCCTGTGGCTGGCAGCCGG - Intergenic
998282366 5:140823743-140823765 CTGTGGCTGTGGCTGTCAGCGGG - Exonic
998401993 5:141852993-141853015 CTGAGGCTGTGGGGGGCAGCTGG - Intergenic
998791170 5:145767346-145767368 CAGTGGAAGTGGCTCTCAGCGGG - Intronic
999238379 5:150113492-150113514 CTTTGGCTTTGGCTATCAGCTGG - Intergenic
999336731 5:150725746-150725768 CTCTTGCTGAGGCTGTCAGCTGG - Intronic
1001221624 5:169905230-169905252 CTGGGGCTGCAGCTGACAGCAGG - Intronic
1002043842 5:176531411-176531433 CTGTGCCTGGGGCTTGCAGCTGG + Intronic
1002420850 5:179148392-179148414 CACTGGCTATGGCTGTCTGCAGG - Intronic
1002431718 5:179207958-179207980 CTGTGGCTGGGGTTGCCACCAGG - Intronic
1002559347 5:180071329-180071351 CCCTGGCTGGGGCTGTCGGCCGG + Intronic
1002957126 6:1877147-1877169 CTGTGCCTCTGGCTGTTAGATGG - Intronic
1005840657 6:29742760-29742782 CTGTGGCTGTGGCAATCCCCAGG - Intergenic
1005848340 6:29800378-29800400 CAGTGGCTGAGGCTGACCGCGGG + Intergenic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1007260981 6:40562906-40562928 CTGTAGCTGTGGCTCTCAAGAGG + Intronic
1008540383 6:52541631-52541653 CAGTGCCTGTGGCTGGCAGGTGG - Intronic
1009272318 6:61629093-61629115 CTGTAATTGTGGCTATCAGCAGG - Intergenic
1014384188 6:120780516-120780538 CTGGAGCTGTGGCTGACAGTAGG + Intergenic
1014935682 6:127382267-127382289 CTTTGGCTCTGGGTGTCAGTTGG - Intergenic
1015591880 6:134830069-134830091 CTGTGGCTGTGGCTGGAACATGG - Intergenic
1018778165 6:167037919-167037941 GTGTGGCTGTGACTGTCCCCTGG + Intronic
1019077081 6:169396402-169396424 CTGTGACTTTGGTTGTCTGCAGG - Intergenic
1019077097 6:169396528-169396550 CTGTGACTTTGGTTGTCTGCAGG - Intergenic
1019280422 7:197029-197051 TTCTGGCTGTGGCTGTCTGCAGG - Intronic
1019406383 7:886250-886272 CTGGGGCTGTGGGTGGCAGAGGG + Intronic
1020081469 7:5288195-5288217 CTCTGCCTGGGGCTGTCGGCAGG - Intronic
1020320927 7:6938409-6938431 TGTAGGCTGTGGCTGTCAGCAGG + Intergenic
1020390657 7:7654471-7654493 CTGTGGATTTGGGTATCAGCAGG - Intronic
1020547813 7:9555552-9555574 CAGTTGATGTGACTGTCAGCTGG + Intergenic
1020762268 7:12283267-12283289 CTTTAGCTGTGGTTGTCACCTGG - Intergenic
1021411169 7:20331085-20331107 CTGTGCCTGCGGGTGTCGGCGGG + Intronic
1022183968 7:27949029-27949051 ATGAGGGTGTGGCTGACAGCAGG - Intronic
1023736837 7:43242800-43242822 CAGTGGCTGTGGCAGGGAGCGGG + Intronic
1024685883 7:51744679-51744701 CTGTGGCTGTGGCTTTCAGTGGG - Intergenic
1025229991 7:57196996-57197018 CTGTTGCTGTGGTTGTGAGTAGG - Intergenic
1025251402 7:57353724-57353746 CTGTGGAAGCGGTTGTCAGCAGG - Intergenic
1027518287 7:79169765-79169787 TTGTTGATGTGGCTGTTAGCTGG - Intronic
1028450620 7:90977993-90978015 CTGGGGCTGGGGCTGTAAGGAGG + Intronic
1030117616 7:106074132-106074154 TGGTGGAGGTGGCTGTCAGCAGG - Intergenic
1032356583 7:131216719-131216741 TTGTGTCTGTGTCTGTCACCTGG + Intronic
1033288711 7:140063124-140063146 CTGTGGCTGTGGCGGCTCGCGGG + Exonic
1033740723 7:144273853-144273875 ATGAGGCTGTGGCTGTCTTCTGG + Intergenic
1033753183 7:144375760-144375782 ATGAGGCTGTGGCTGTCTTCTGG - Intronic
1034206993 7:149325887-149325909 CTGTGGCTGTGTCTCCCTGCAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034398406 7:150845621-150845643 CTGCAGCTGTGTCTGGCAGCCGG - Intronic
1035163408 7:156967994-156968016 CTGTGGCTGCGGCTGTCTTGTGG - Intronic
1035222083 7:157411809-157411831 CTGTGGCTATGGCTGTGGGCGGG + Intronic
1035257901 7:157643697-157643719 CTGTGGGTGCGGGTGTCTGCAGG - Intronic
1035413585 7:158666061-158666083 CTGTGGCTGTAGGTGAGAGCTGG - Intronic
1036066667 8:5388366-5388388 ACGTGGCTGTCACTGTCAGCTGG - Intergenic
1036074277 8:5477500-5477522 CAGTGGCTGTGGGTGTGAGGGGG - Intergenic
1036380596 8:8233982-8234004 TGCAGGCTGTGGCTGTCAGCAGG - Intergenic
1036848973 8:12188653-12188675 TGCAGGCTGTGGCTGTCAGCAGG + Intronic
1036870335 8:12430931-12430953 TGCAGGCTGTGGCTGTCAGCAGG + Intronic
1037645964 8:20793037-20793059 CTGTGACTCAGGCTGTTAGCAGG + Intergenic
1038210624 8:25516313-25516335 CTGTGGCTCAGGCTGTCAAGAGG + Intergenic
1038691184 8:29764985-29765007 TTGTTGCTGGAGCTGTCAGCTGG - Intergenic
1040818408 8:51533012-51533034 TTGCTGCTGTGGCTGTCAGGAGG - Intronic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1042595595 8:70444361-70444383 CTGTGGCTGTGGCTATAAAAGGG + Intergenic
1042928585 8:73991670-73991692 CTGTGGCGGACGCTGCCAGCAGG + Intronic
1043161660 8:76854252-76854274 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1043220462 8:77655837-77655859 CTGTGGAAGTGGCTCTCAGCAGG - Intergenic
1043499369 8:80837847-80837869 CTGTGGCAGTGGCAGTCAGGGGG - Intronic
1044621315 8:94193069-94193091 CTGTGCTTGTGGCTTTCACCTGG + Intronic
1044995233 8:97831867-97831889 CTCTGGCTTTGGCTGTAAGGAGG + Intronic
1045048218 8:98299411-98299433 ATGTTGCTGTGGCTGTTAGGTGG - Intergenic
1047689223 8:127334027-127334049 ATGTGACTGAGGCTGTCAACTGG - Intergenic
1047927800 8:129698151-129698173 CTGTTCCTGGGGCTGTCAGTGGG - Intergenic
1048226525 8:132592495-132592517 CTGAGGTTGTGGATGTAAGCAGG + Intronic
1048546335 8:135390862-135390884 CAGAGCATGTGGCTGTCAGCCGG - Intergenic
1049063591 8:140295430-140295452 GAGAGGCTGTGGCTGTCAGGTGG - Intronic
1049189301 8:141278173-141278195 CTGGTGCTGGGGCTGTCAGAGGG - Intronic
1049507605 8:143011945-143011967 CTGTGGTTGGTGCTGTGAGCAGG - Intergenic
1049754995 8:144307153-144307175 CTGAGGCAGTGCCTGGCAGCTGG - Intronic
1049786053 8:144451382-144451404 CTGTGGCTGTGGCCGTGGCCAGG - Intronic
1050981178 9:12017960-12017982 TGGTGGAGGTGGCTGTCAGCAGG + Intergenic
1051366236 9:16323366-16323388 TTGTGGCTGTGGCTGGAGGCAGG - Intergenic
1051955967 9:22693649-22693671 ATGTGGCTGTGGCAGTCTGCAGG + Intergenic
1054923863 9:70568834-70568856 CTGGGTCAGTGGCTGTCAACTGG + Intronic
1060222188 9:121770405-121770427 CAGTGGCTCTGACTGGCAGCAGG + Intronic
1060303465 9:122390235-122390257 ATGTGGCTGTGGATGTCATCAGG + Exonic
1060530301 9:124343786-124343808 CTCCGGCTGTGTCTGTCACCAGG - Intronic
1061784046 9:133014441-133014463 GACTGGCTGTGGCTGTCATCTGG + Intergenic
1061922044 9:133787772-133787794 GTGGGCCTGTGGCTGCCAGCGGG - Intronic
1062053922 9:134461047-134461069 GGATGGGTGTGGCTGTCAGCAGG + Intergenic
1062263994 9:135678465-135678487 CTGTGGCTGTGGCTGGGGGGTGG + Intergenic
1186013985 X:5169868-5169890 CTGTTGCTATGGTTGTGAGCAGG - Intergenic
1187278644 X:17839009-17839031 CAGTGGCTGTGGTTGGCAGCGGG - Intronic
1187403768 X:18984520-18984542 CCTTGGCTGTGGTTGGCAGCCGG - Exonic
1187486092 X:19705709-19705731 CTGTTACTGTGGATGTCAACTGG + Intronic
1187799237 X:23042073-23042095 GTTTGGCTGAGGCTGTCAGTGGG - Intergenic
1189313409 X:40035858-40035880 CTCCAGCTGGGGCTGTCAGCTGG - Intergenic
1189605686 X:42675292-42675314 CTGGGGCTGTAGCTGTGTGCAGG + Intergenic
1190214713 X:48472336-48472358 GTGTGGCTGTGGCTGAGAACGGG + Intergenic
1190582557 X:51903163-51903185 CTTTGACTGTGACTGTGAGCAGG + Intergenic
1190605563 X:52139081-52139103 CTGTGGCTGTGAGGGTCATCTGG - Intergenic
1190817057 X:53938306-53938328 CTGTGGCTGTGGCTGGGCCCTGG - Exonic
1190817058 X:53938312-53938334 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1192001331 X:67154967-67154989 TTGTGGATGTGGCTTTCAGTGGG + Intergenic
1192178226 X:68899076-68899098 GTGTGGCTGGGGCTGTGGGCAGG + Intergenic
1197204471 X:123777926-123777948 CTGCTGCTGTTGCTCTCAGCAGG - Intergenic
1199106330 X:143873366-143873388 CTGAGGCTGTTGCAGTCAGCTGG - Intergenic