ID: 998282534

View in Genome Browser
Species Human (GRCh38)
Location 5:140825563-140825585
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 2, 1: 4, 2: 27, 3: 182, 4: 682}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998282533_998282534 -8 Left 998282533 5:140825548-140825570 CCAAGTAGCTGGGATTACAGGCA 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282529_998282534 2 Left 998282529 5:140825538-140825560 CCTTATCTTCCCAAGTAGCTGGG 0: 3
1: 297
2: 9113
3: 112535
4: 223144
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282526_998282534 24 Left 998282526 5:140825516-140825538 CCAGGTTCAAGCGATTCTCCTGC 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282525_998282534 25 Left 998282525 5:140825515-140825537 CCCAGGTTCAAGCGATTCTCCTG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282524_998282534 28 Left 998282524 5:140825512-140825534 CCTCCCAGGTTCAAGCGATTCTC 0: 23056
1: 86015
2: 148378
3: 189355
4: 137836
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282532_998282534 -7 Left 998282532 5:140825547-140825569 CCCAAGTAGCTGGGATTACAGGC 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682
998282527_998282534 6 Left 998282527 5:140825534-140825556 CCTGCCTTATCTTCCCAAGTAGC 0: 3
1: 185
2: 6845
3: 93598
4: 196449
Right 998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG 0: 2
1: 4
2: 27
3: 182
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900506962 1:3034425-3034447 CACAGGCATGTACACACACGTGG + Intergenic
900887619 1:5426533-5426555 TACAGTCATGTGCCAATAGCTGG + Intergenic
901548094 1:9974364-9974386 TACAGGCATGCCACCACATCTGG + Intronic
901669382 1:10846607-10846629 TACAGGCATGTGCGGATACAGGG - Intergenic
901702308 1:11052203-11052225 TACAGGCATGAGCCACCACCCGG + Intergenic
901760831 1:11470156-11470178 TACAGGTATGAGACCACACCTGG - Intergenic
901925314 1:12562243-12562265 TACAGGCATGTCACCACTCCTGG - Intergenic
902831626 1:19017569-19017591 TACAGGCATGAGCCACCACCCGG - Intergenic
902883792 1:19390588-19390610 CACAGGAGTGTGCCCACCCCAGG + Intronic
903470076 1:23580696-23580718 GACAGGCAGGTGCCAACCCCAGG - Intergenic
903796876 1:25935889-25935911 TACAGGCATGGCACCACCCCCGG + Intergenic
903805206 1:26000251-26000273 TACAGGCACATTACCACACCTGG + Intergenic
903890499 1:26567162-26567184 TACAGGCGTGCCACCACACCTGG + Intronic
903924191 1:26819837-26819859 TACAGGCATGAGCCACCAACCGG - Intergenic
904088551 1:27928495-27928517 TACAGGTGCGTGCCCACAACTGG + Intergenic
904203942 1:28840392-28840414 TACAGGCATGAGCCACTACCTGG + Intronic
904371864 1:30052860-30052882 TACAGGCAAGTCACCACACCCGG + Intergenic
904588494 1:31593739-31593761 TACAGGCATATCACCACACCTGG + Intergenic
904628893 1:31826715-31826737 TACAGGCATGAGCCACCACCCGG + Intergenic
905189533 1:36222984-36223006 TACGGGCATATGCCACCACCCGG - Intergenic
905273039 1:36799465-36799487 TACAGGCATGTGTGCACAGTGGG - Exonic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906109700 1:43314443-43314465 TACTGGCAGGTGGCCACAGCAGG - Intronic
906193030 1:43910914-43910936 AAGAGGGATGTGCCCACCCCAGG + Intronic
906340864 1:44979515-44979537 TACATGCATGCCACCACACCTGG - Intronic
906348728 1:45038744-45038766 TACAGGCGACTGACCACACCTGG + Intronic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
906572364 1:46854431-46854453 TACAGGCGTGCCACCACACCTGG - Intergenic
907035577 1:51213210-51213232 TACAGGCATGGGCCCATGCCTGG - Intergenic
907329751 1:53663275-53663297 TACAGGGCTGGGCCCACAGCAGG + Intronic
907582787 1:55586961-55586983 TCCAGGTATGTGCCCAAGCCTGG - Intergenic
907679924 1:56553497-56553519 TACAGCCATGACACCACACCAGG + Intronic
907902102 1:58750488-58750510 CACTGGCATGTGGCCACAGCTGG + Intergenic
908111429 1:60902477-60902499 CACAGTCATGTGTCCACACCTGG + Intronic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
908588120 1:65596952-65596974 TACAGGAATGTGCACAGATCGGG - Intronic
909388043 1:75082894-75082916 TACAGTCATGTGCTGACACTTGG + Intergenic
909603557 1:77485972-77485994 TATAGGCATGCCACCACACCTGG - Intronic
909763265 1:79320883-79320905 TACAGGCATGAGCCAGCGCCTGG + Intergenic
909765420 1:79349602-79349624 TACAGGCATGAGCCAGCGCCCGG + Intergenic
910054940 1:83022467-83022489 TATAGGCACATGCCAACACCTGG + Intergenic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910868483 1:91809598-91809620 TACAGCCATGTGTACACACTGGG + Intronic
910887404 1:91979252-91979274 TACAGGCATGCGCCACCACACGG + Intronic
910917547 1:92306696-92306718 TACAGGCGTGCCACCACACCTGG - Intronic
910943438 1:92561911-92561933 TATAGGCGTGCGCCCACACCTGG + Intronic
911463698 1:98223890-98223912 TACAGACATGAGCCCACACCTGG - Intergenic
911498124 1:98655222-98655244 TCCAGGCATGGACACACACCAGG - Intergenic
912356907 1:109061738-109061760 TACAGGCATGCCACCACGCCCGG + Intergenic
912887133 1:113486790-113486812 TACAGTCATGTGCCACCACGTGG + Intronic
913438533 1:118872476-118872498 TACAGGCATGAGCCACCATCCGG + Intergenic
913718237 1:121561309-121561331 CACACGCATGTGCACACACACGG + Intergenic
913965696 1:143375841-143375863 TACAGGCTTGCCACCACACCTGG + Intergenic
914060070 1:144201449-144201471 TACAGGCTTGCCACCACACCTGG + Intergenic
914119080 1:144764920-144764942 TACAGGCTTGCCACCACACCTGG - Intergenic
914436804 1:147667713-147667735 TACAGGCGTGAGCCAGCACCCGG - Intronic
914763062 1:150614626-150614648 TACAGGCATGAGCCACCACCTGG + Intronic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915424837 1:155817128-155817150 TACAGGCATGCCTCCTCACCAGG + Intronic
915435067 1:155898389-155898411 TACAGGCATGAGCCACCACCTGG - Intronic
915696781 1:157751472-157751494 TTCAGGCATGTGTCCACACGGGG - Intronic
915952144 1:160196616-160196638 TACAGGCACGCCACCACACCTGG + Intronic
915968318 1:160331803-160331825 CAGATGCATGTGACCACACCTGG - Intronic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
916702828 1:167315661-167315683 TACCAGCATGTCACCACACCTGG - Intronic
916723244 1:167501193-167501215 TACAGGCATGCCACCACACCTGG + Intronic
916760698 1:167814848-167814870 TACAGGCATGAGCCCACGTGTGG - Intronic
916917820 1:169428794-169428816 TACAGGCACGCCACCACACCTGG + Intronic
917236669 1:172900063-172900085 TACAGGTATGTGCCACCACATGG + Intergenic
917331978 1:173890137-173890159 TACAGGCGTGTGACCACACCTGG + Exonic
917452692 1:175160370-175160392 TACGTGCATGTGCACACACTTGG + Exonic
917703792 1:177611181-177611203 TACAGGTGATTGCCCACACCAGG + Intergenic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
918131637 1:181634811-181634833 TCCAGGTATGTCCCCTCACCTGG + Intronic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
919704095 1:200659826-200659848 TACAGGCATGCCACCACACCTGG + Intronic
920320396 1:205117383-205117405 TACAGGCATGAGCCACCACACGG - Intronic
920411612 1:205765923-205765945 TACACGCATGCCACCACACCTGG - Intergenic
920514292 1:206573183-206573205 TACAGGCATGAGCCACCACACGG - Intronic
921067778 1:211634744-211634766 CACAGGCATGTGACCTCGCCCGG - Intergenic
921094690 1:211876275-211876297 TACAGGCACACGCCCACACCTGG + Intergenic
921151109 1:212403838-212403860 TACAGGCGTGCCACCACACCTGG + Intronic
921247033 1:213255162-213255184 CACAGGCATGGGACCACACTTGG - Intronic
921443308 1:215214683-215214705 TACAGGCATGCCACCACACCAGG - Intronic
921688654 1:218121439-218121461 TACAGGCAGGCTACCACACCTGG - Intergenic
921827594 1:219691242-219691264 TACAGGCATGAGCTTGCACCTGG - Intronic
922453370 1:225754639-225754661 TACAGGCATGAGCCACCACATGG + Intergenic
922719846 1:227894794-227894816 CACAAGCATGTGCTCCCACCTGG - Intergenic
923172860 1:231432974-231432996 TACAGGCATGCACCACCACCTGG - Intergenic
923315788 1:232778840-232778862 TACAGGCGTGTGGCACCACCCGG - Intergenic
923753084 1:236764977-236764999 TACAGGCATGCAACCAAACCCGG - Intergenic
923995146 1:239485423-239485445 TACAGGCACATGCCACCACCTGG + Intronic
924587605 1:245373915-245373937 TACAGGCATGCCACCACGCCTGG - Intronic
924760776 1:246983241-246983263 TACAGGCATGTGCCACCATGTGG - Intronic
1063442489 10:6084250-6084272 TACAGGCATAAGCCTGCACCTGG - Intergenic
1063861351 10:10311214-10311236 TACAGGCATGCCACCACACTTGG - Intergenic
1063979810 10:11444346-11444368 TAGAGGCAAGTGCCCACAGCTGG - Intergenic
1064074673 10:12259181-12259203 TACAGGCATGAGCCACCAGCTGG + Intergenic
1064351505 10:14581574-14581596 CACCGGCAGGTGTCCACACCAGG + Intronic
1064546257 10:16452891-16452913 TACAGGCATGCCCTCACACCCGG + Intronic
1064983315 10:21185637-21185659 TACAGGCATGCCACCACACCTGG + Intergenic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1065302240 10:24333298-24333320 TACAGGCATGAGCCACCACAGGG + Intronic
1065505411 10:26425654-26425676 TACAGGCACGCCACCACACCTGG - Intergenic
1065826834 10:29580051-29580073 TACAGGCATAAGCCACCACCAGG - Intronic
1067017267 10:42767676-42767698 TACCGGCATGAGCCACCACCCGG - Intergenic
1067111737 10:43406233-43406255 TGCAGGCATCTACCCCCACCGGG + Intronic
1068880606 10:62044638-62044660 TACAGTCATGAGCCACCACCAGG + Intronic
1069453023 10:68532364-68532386 TACAGGCATGAGCCACAACCAGG + Intergenic
1069468540 10:68664527-68664549 TGCAGGCAGGTGTCCACACCCGG + Intronic
1069520959 10:69120839-69120861 TACAGGCATGCCCCACCACCTGG + Intergenic
1069549900 10:69356289-69356311 TACAGGCATACGACCACACCTGG - Intronic
1070090576 10:73281323-73281345 TACAGACATGCCACCACACCTGG + Intronic
1070125373 10:73617313-73617335 TACAGGCATGCGCCACCGCCTGG - Intronic
1070153582 10:73819851-73819873 ACCAGGCAGGTGCCCAGACCTGG + Intronic
1070293936 10:75142708-75142730 TACAGGCATGAGCCACCACCCGG + Intronic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1070450607 10:76553607-76553629 TAAAGGCCTGTGGCCACACATGG + Intronic
1070999471 10:80816422-80816444 TACAGGCAAGCCACCACACCTGG - Intergenic
1071018661 10:81027523-81027545 TGCAGGCATTTCCCCAGACCTGG + Intergenic
1071304476 10:84286196-84286218 TACAGGCATGAGCCAACATGTGG - Intergenic
1071467722 10:85956568-85956590 CACATGCATGAGCCCAAACCAGG - Intronic
1071555259 10:86596580-86596602 TACAGGCATGTGCCACCAACGGG - Intergenic
1071580531 10:86765341-86765363 TACAGGCGTGCCACCACACCCGG - Intronic
1071684236 10:87737680-87737702 TACAAGCATGCCACCACACCTGG - Intronic
1072161546 10:92771526-92771548 TACAGGCGTGAGCCATCACCCGG + Intergenic
1072419751 10:95280232-95280254 TACAGGCACCTGCCACCACCTGG - Intronic
1073312367 10:102552290-102552312 TATAGGCATGCCACCACACCTGG - Intronic
1074074648 10:110111770-110111792 TACAGGCATGCGCCACCACCCGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1074323426 10:112424535-112424557 AACAGATATGTCCCCACACCAGG + Intronic
1074411954 10:113236030-113236052 TACAGGCGTGCCACCACACCCGG - Intergenic
1074577243 10:114681723-114681745 CCCAGGCTTGTGACCACACCAGG - Intronic
1075056953 10:119226120-119226142 TACAGGCATGAGCCAGCACCCGG + Intronic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1075471489 10:122693629-122693651 TACAGGCATGTCACCACACCCGG + Intergenic
1075489995 10:122858599-122858621 TACACACCTGTGCCCACAGCAGG + Intronic
1075520429 10:123140377-123140399 TAAAGGCAGGCGGCCACACCCGG - Intergenic
1075812957 10:125240388-125240410 TACAGGCATGCCACCACACCTGG + Intergenic
1076671119 10:132121623-132121645 CACGGCAATGTGCCCACACCTGG - Intronic
1077070763 11:670903-670925 GACTGGCATGTCACCACACCTGG + Intronic
1077243412 11:1523960-1523982 CACAGCCCTGTGCCCACAACAGG + Intergenic
1077711919 11:4545729-4545751 TACAGCCATGTGCTCACAGTAGG - Exonic
1078052595 11:7980014-7980036 TACAGGCATGAGCCACCGCCTGG + Intronic
1078198681 11:9159459-9159481 TACAGGCATGCACCACCACCTGG + Intronic
1078367252 11:10716967-10716989 TTTAGACATGTGCCCAAACCTGG + Intergenic
1079997991 11:27316584-27316606 TACAGGCATGTAGCCATGCCCGG - Intergenic
1080478686 11:32623147-32623169 TACAGGCATGCCCCCACATGTGG + Intronic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081143984 11:39538016-39538038 TACAGGCGTGAGACCACACCTGG + Intergenic
1081978454 11:47250882-47250904 TACAGGCGTGAGCACGCACCCGG - Intronic
1082045995 11:47728017-47728039 TACAGGCATGCGACCACGCCTGG + Intronic
1082080267 11:48007382-48007404 TACAGGCATGAGCCACCACACGG + Intronic
1082669499 11:56017042-56017064 TGCAGGCATGCGCCGCCACCAGG - Intergenic
1083461575 11:62816421-62816443 TACAGGCATGTCACCATGCCAGG + Intronic
1083570317 11:63757499-63757521 TACAGGCATGTGCCATGCCCTGG + Intronic
1083848383 11:65350522-65350544 TACAGGCATGCCACCACACCCGG + Intronic
1084020891 11:66417312-66417334 CACATGCCTGTGCCCACACCAGG + Intergenic
1084279164 11:68075658-68075680 TACAGGCATGAGCCACCGCCTGG - Intronic
1084409047 11:68995653-68995675 TACAGGCGTCTGCCACCACCTGG + Intergenic
1084570387 11:69956287-69956309 TGCAGGCATCTGCAAACACCAGG - Intergenic
1084895888 11:72267758-72267780 TACAGGCATTAGCCAGCACCTGG + Intergenic
1085307205 11:75493540-75493562 TACAGGCATGCTACCACGCCAGG + Intronic
1086414143 11:86571838-86571860 TAAGGGCCTGTGGCCACACCTGG + Intronic
1087264212 11:96043019-96043041 TACAGGCATGAGCCACCACCCGG + Intronic
1088166942 11:106950429-106950451 TTCAGCTCTGTGCCCACACCTGG + Intronic
1088251130 11:107861722-107861744 TACAGGCATGTGCCCATGCCCGG + Intronic
1088281871 11:108143161-108143183 TACAGGCATGCTACCACACCTGG - Intronic
1088665728 11:112091791-112091813 TACAGGCGTGAGACCACGCCTGG - Intronic
1089073904 11:115721710-115721732 TGCAGGCATGTGCAACCACCTGG + Intergenic
1089230862 11:116974529-116974551 TACAGGCATGTGCCACCATAGGG + Intronic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1089430930 11:118423884-118423906 TACAGGCATGCCACCACGCCCGG + Intronic
1089449126 11:118579394-118579416 TACAGGCATGAGCCACCGCCCGG - Intronic
1090228135 11:125083782-125083804 TACAGGTATGTGGTCAGACCTGG - Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1090694886 11:129229955-129229977 CACAGGCATGCCACCACACCTGG + Intronic
1090715609 11:129427813-129427835 GCCAGGCATGTACCCACTCCAGG - Intronic
1090823534 11:130366654-130366676 TACAGGCACATGCCACCACCTGG - Intergenic
1091395830 12:153754-153776 TAGGGGCATGTGTCCCCACCTGG - Intronic
1091927125 12:4361890-4361912 TACAGGCATGAGCCACCACCCGG + Intergenic
1092138239 12:6164569-6164591 TACAGGCGTGAGCCCATGCCCGG - Intergenic
1092169198 12:6362818-6362840 TACAGGCTTGTGCCACCACATGG + Intronic
1092249328 12:6883916-6883938 CACAGCCATGTGCACTCACCTGG - Intronic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1092341289 12:7678407-7678429 TACAGGCGTGACACCACACCCGG - Intergenic
1092668214 12:10830923-10830945 TACAGGCCTGAGCCCGCACCCGG + Intronic
1093064633 12:14644206-14644228 TACAGGCATGAGCCATCACGGGG - Intronic
1093486101 12:19654725-19654747 TACAGACATGTGCCAAATCCTGG - Intronic
1093679553 12:21986034-21986056 TACAGGCATACCACCACACCTGG + Intergenic
1094264078 12:28535751-28535773 TACAGGCATGATACCGCACCAGG - Intronic
1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG + Intergenic
1094452849 12:30600863-30600885 TACAGGCATTTTCCCAGACCTGG + Intergenic
1094749661 12:33391210-33391232 TACAGGCGTGAGCCAACGCCTGG + Intronic
1095772866 12:45981652-45981674 TACAGGCATGCCACCACACTCGG - Intronic
1096077191 12:48813297-48813319 TACAGGCACGCCACCACACCAGG - Intergenic
1096247714 12:50002744-50002766 TACAGGCATGAGCCATCGCCTGG - Intronic
1096309142 12:50505063-50505085 GACAGACACGGGCCCACACCCGG - Intronic
1096334383 12:50742254-50742276 TACAGGCATGCCACCACACCTGG - Intronic
1096350119 12:50890892-50890914 TACAGGCATACCACCACACCTGG - Intergenic
1096695079 12:53343905-53343927 TACAGGCATGTGCCAAAAATTGG - Intronic
1097862006 12:64527272-64527294 TACAGTCATCTGCCAACACATGG - Intergenic
1097921055 12:65074540-65074562 TACAGGCATGAGCCAGCACCTGG - Intronic
1098860267 12:75702037-75702059 TACAGTGATGTGCCGACAACTGG + Intergenic
1098913777 12:76236758-76236780 CTCAGGCATGTGGCCACACCTGG + Intergenic
1098952330 12:76653781-76653803 TACAGGCGTGCCACCACACCTGG - Intergenic
1099412789 12:82351593-82351615 TACATGTACGTGCCAACACCTGG - Intronic
1099483335 12:83196171-83196193 TACAGGCATGAGCCACCTCCCGG - Intergenic
1100498633 12:95151409-95151431 TACAGGCATGCCACCACACCTGG + Intronic
1100704080 12:97181411-97181433 TACAGACATGTTTCCACACATGG - Intergenic
1101137030 12:101754284-101754306 TACAGGCATGCCACCACACCCGG - Intronic
1101340591 12:103839515-103839537 TACAGGCGTGAGCTCACACCTGG + Intronic
1101363056 12:104045642-104045664 TTTAGGCATGTGGCCAAACCTGG + Intronic
1101528879 12:105556655-105556677 TACAGGCATGAGCCACCACGTGG + Intergenic
1101972638 12:109326660-109326682 TACAGGCATGTCACCATCCCCGG + Intergenic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1102685667 12:114722669-114722691 TACAGGCATGAGCCACCACAGGG + Intergenic
1102975250 12:117202387-117202409 TACAGGCAGGAGCCCACAAAGGG + Intergenic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1103474996 12:121211462-121211484 TACAGGCGTGAGCCCCCACGCGG + Intronic
1103487754 12:121294893-121294915 TACAGGCATGAGCTGCCACCTGG - Intronic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103818209 12:123676001-123676023 TACAGGCATGAGCCACCACCTGG - Intronic
1103936160 12:124478030-124478052 GACAGGCATGGGCCCACTCATGG + Intronic
1105904835 13:24797531-24797553 CACAGACATTTGCCCAAACCAGG - Intronic
1105958266 13:25304655-25304677 TACAGGCACGCCACCACACCCGG + Intronic
1106332637 13:28753695-28753717 TACAGGCATGTGAGTACGCCAGG - Intergenic
1106498314 13:30303422-30303444 TTCAGGCATGTGGCCACACCCGG - Intronic
1107503009 13:41000362-41000384 TACAGGCACGCCACCACACCGGG + Intronic
1107511298 13:41088119-41088141 AACAGGCATGCCACCACACCTGG + Intergenic
1107795050 13:44043208-44043230 TACAGGCAACTCCCCACAGCTGG - Intergenic
1107917165 13:45164455-45164477 TACAGGCATGAGCCACTACCTGG - Intronic
1108626706 13:52236158-52236180 TGCAGGCATTTTCCCAAACCTGG + Intergenic
1108659362 13:52570327-52570349 TGCAGGCATTTTCCCAAACCTGG - Intergenic
1109146341 13:58784708-58784730 TACAGGCGTGCCACCACACCCGG + Intergenic
1109440856 13:62370959-62370981 TATAGGCATGAGCCGCCACCTGG + Intergenic
1109918425 13:69022901-69022923 TACAGGCGTGTGACCAGGCCTGG - Intergenic
1109955496 13:69559841-69559863 TACAAGCTTGTAACCACACCTGG + Intergenic
1111057027 13:82964669-82964691 TACAGGCATGAGCCACCACCAGG - Intergenic
1112098755 13:96164414-96164436 TACAGGCACGTCACCACGCCAGG - Intronic
1112511650 13:100015133-100015155 TACAGGCATTCCACCACACCTGG + Intergenic
1112560910 13:100512880-100512902 TTCAGGAATGTGCCCCTACCTGG - Intronic
1112863308 13:103862207-103862229 TACAGGCATGCGCCACCACGCGG + Intergenic
1112970311 13:105253610-105253632 TACAGGCATGTCACCACGCAGGG - Intergenic
1113474135 13:110567981-110568003 TAGAGGCTTGAGCCCACATCTGG + Intergenic
1113947805 13:114054390-114054412 CACAGGCATAAGCCCAAACCTGG + Intronic
1115207953 14:30933136-30933158 CACAGGCGTGTGACCACACCTGG - Intronic
1115211687 14:30972931-30972953 TACAGGCGTGAGCCCGCACCCGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1115269495 14:31536164-31536186 TACAGGCATGTGCCGTCACTGGG + Intronic
1115591152 14:34866345-34866367 TACAGGCATGTGCCACCACGTGG - Intronic
1115611476 14:35052482-35052504 TACAGGTATGAGCCCGCGCCTGG + Intronic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116377088 14:44216619-44216641 TACAGGCATGCCACCACACCTGG - Intergenic
1116399110 14:44483657-44483679 TACAGGCATGTGGCCAGGCACGG + Intergenic
1116418242 14:44704463-44704485 TACAGGCATGCCACCACAACTGG - Intergenic
1116963647 14:50992430-50992452 TATAGGCATGCCACCACACCTGG - Intronic
1117089631 14:52236930-52236952 TACAGGTGTGTGCCCACGCCCGG - Intergenic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117349656 14:54869012-54869034 TACAGGCATGCACCACCACCTGG + Intronic
1117400741 14:55356586-55356608 TACAGGCATGCGCCACCACGTGG + Intronic
1117404911 14:55392504-55392526 TAGATGCATGTCACCACACCTGG - Intronic
1117724044 14:58654994-58655016 TACAGGCATGCCACCACGCCTGG + Intergenic
1118031804 14:61825403-61825425 TACAGGCATGAGCCCCAGCCAGG - Intergenic
1118597865 14:67449919-67449941 TACAGGTATGTGCCTCCACAAGG - Intronic
1118834524 14:69467493-69467515 TACAGGCATGAGCCACCACACGG - Intergenic
1119067148 14:71540403-71540425 TACAGACATGAGCCACCACCAGG - Intronic
1119197858 14:72731023-72731045 TACAGGCATGTGCCACCATCTGG - Intronic
1119277395 14:73371062-73371084 TACAGGCGTGAGCCCGCATCAGG + Intronic
1119663933 14:76470826-76470848 TACAGGCATGTGCCAACATGTGG + Intronic
1119683232 14:76608678-76608700 TACAGGCATGCCACCACACCTGG - Intergenic
1119848499 14:77848178-77848200 TACAGGCATGAGCCCCGGCCTGG + Intronic
1120170096 14:81239469-81239491 TACAGGCATGACACCACGCCTGG + Intergenic
1120454883 14:84718377-84718399 TGCAGGCATTTTCCCAGACCTGG + Intergenic
1120538472 14:85726455-85726477 TATAGGCATACGACCACACCTGG + Intergenic
1120931685 14:89855198-89855220 TACAGGCATGCCACCACACCTGG - Intronic
1120963528 14:90147388-90147410 TACAGACATGCTACCACACCTGG + Intronic
1121339156 14:93094692-93094714 GACGAGCATGTGTCCACACCTGG + Intronic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1122024363 14:98864414-98864436 TCCATGCATGTGGCCACAGCAGG + Intergenic
1122520748 14:102341838-102341860 TACAGGACTGTGCCCAAGCCAGG + Exonic
1122727764 14:103770236-103770258 TACAGGCATGAGCTACCACCTGG - Intronic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122993894 14:105252197-105252219 TACAGGCATGAGACCGCACCTGG - Intronic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125545818 15:40503949-40503971 TACAGGCATGACCCACCACCCGG - Intergenic
1125650673 15:41314969-41314991 TACAGGCATGCCACCACATCTGG - Intronic
1125669826 15:41462894-41462916 TATAGGCGTGTGCCACCACCTGG + Intronic
1125830771 15:42715781-42715803 TACAGGCATGAGCCACCGCCCGG + Intronic
1126317216 15:47383039-47383061 TACAGGCATGAGCCACCACCTGG + Intronic
1126319510 15:47407087-47407109 TACAGGCATGAGCCACCCCCCGG - Intronic
1126827502 15:52566565-52566587 TACAGACATGCCACCACACCTGG + Intronic
1127240245 15:57105334-57105356 TAAAGACATGTTCCCTCACCAGG - Intronic
1128842393 15:70860553-70860575 TACAGGCATGCCACCACACCTGG + Intronic
1128966822 15:72067422-72067444 TACAGGTGCCTGCCCACACCTGG + Intronic
1129112805 15:73347775-73347797 TTCAGGCACGTGCCAACTCCAGG - Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129403960 15:75302150-75302172 TACAGGCAAGTGCCACCACCAGG + Intergenic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129512203 15:76132652-76132674 TACAGGCATGCGCCACCACCTGG - Intronic
1129744925 15:78011787-78011809 TACAGGCATGTGCCACCGTCTGG + Intronic
1129775297 15:78232823-78232845 TACAGGCACGTACCACCACCTGG + Intronic
1130289112 15:82581115-82581137 TACAGGCATGAGCCAATGCCTGG + Intronic
1130402082 15:83566631-83566653 TACAGACGTGTTACCACACCTGG - Intronic
1130528868 15:84730535-84730557 TACAGACATGTGCCACCACATGG + Intergenic
1130554776 15:84915017-84915039 TGCAGGGATGGGCCCACGCCAGG - Intronic
1131085481 15:89572482-89572504 TACAGGCATGAGCCACCACCCGG - Intergenic
1131181993 15:90246645-90246667 TACAGGCATCTGCCACCACACGG - Intergenic
1131261889 15:90891890-90891912 TCCAGGCAGGTGCCCTGACCAGG - Intronic
1131733898 15:95311878-95311900 TACAGGCGTGCTACCACACCCGG + Intergenic
1132397079 15:101481999-101482021 CACACGCATGTGCACGCACCCGG + Intronic
1132424730 15:101705665-101705687 TACAGGTTTGTGTCCACACATGG - Exonic
1132488778 16:213040-213062 TACAGGCGTGAGCGCACACCTGG + Intronic
1132781754 16:1630425-1630447 TACAGGCACGAGCCACCACCTGG + Intronic
1133097016 16:3454243-3454265 TACAGGCAAGTGCCATGACCTGG + Intronic
1133139597 16:3734480-3734502 CACAGGCAGGTGCCCCCTCCTGG + Intronic
1133786845 16:8980531-8980553 TATAGGCATGAGCCCACAATTGG - Intergenic
1134266347 16:12696216-12696238 AGCAGGCATGTCCCCAAACCAGG + Intronic
1134438257 16:14281524-14281546 TACAGGCATGTGCCACCACGTGG - Intergenic
1134445729 16:14329864-14329886 TACAGGCACATGCCCAAACCTGG - Intergenic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1135028502 16:19017542-19017564 TACAGGCATGAACCACCACCTGG - Intronic
1135257660 16:20954080-20954102 TACAAGCATGCCACCACACCCGG - Intronic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136045675 16:27613131-27613153 TACAGGCAGGTGCCAATACATGG - Intronic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1136491026 16:30608555-30608577 TACAGGCATGAGCCACCAGCCGG + Intronic
1136704387 16:32173985-32174007 TACAGGCATGAGCCACCGCCTGG + Intergenic
1136763525 16:32755421-32755443 TACAGGCATGAGCCACCGCCTGG - Intergenic
1136804575 16:33114965-33114987 TACAGGCATGAGCCACCGCCTGG + Intergenic
1137009526 16:35309222-35309244 TGCAGGCTGGAGCCCACACCAGG + Intergenic
1138380239 16:56595707-56595729 TACAGGCATGTACCACCACCTGG - Intergenic
1138634645 16:58328020-58328042 TAAAGGCGTGTGCCACCACCTGG - Intronic
1138814432 16:60188019-60188041 TACAAGCATGCAACCACACCAGG + Intergenic
1139342480 16:66277532-66277554 TGCAGGCATTTTCCCAGACCTGG + Intergenic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139646358 16:68333911-68333933 TACAGGCATGCACCACCACCTGG + Intronic
1139677699 16:68536446-68536468 TACCGGCATGCCACCACACCTGG + Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1140795319 16:78432246-78432268 TACAGGCATGCCACCACACCTGG + Intronic
1140799302 16:78470668-78470690 TACAGGCACGCCACCACACCTGG + Intronic
1141321546 16:83014588-83014610 TACAGGCATGGGCCACCACTCGG - Intronic
1141413663 16:83853833-83853855 TACAGGCATGAGCCCAAGACTGG + Intergenic
1141838353 16:86557934-86557956 TAATGGCATGTGCCCATCCCTGG + Intergenic
1203065674 16_KI270728v1_random:1015742-1015764 TACAGGCATGAGCCACCGCCTGG - Intergenic
1142587568 17:983233-983255 TACAGGCATGAGCCACCACCCGG + Intergenic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1142950416 17:3473771-3473793 TACAAGCATGAGACCACACCTGG + Intronic
1142988480 17:3712669-3712691 TACAGGCATGAGCCAAATCCGGG - Intergenic
1143181093 17:4984874-4984896 TACAGGCACGCCACCACACCTGG - Intronic
1143657501 17:8304395-8304417 TACAGGCATGCGCCACCGCCAGG + Intergenic
1143685075 17:8507334-8507356 TGCAGGCAGGTGCCCACTCTTGG - Intronic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1143853024 17:9827010-9827032 TACAGGTACGTGCCACCACCCGG + Intronic
1144184081 17:12779807-12779829 TACAGGCATGAGCCACCGCCCGG + Intergenic
1145004115 17:19327530-19327552 TACAGGAATGTCACCACGCCCGG - Intronic
1145371120 17:22306912-22306934 TACAGGCATGAGCCAGCGCCTGG - Intergenic
1145742585 17:27288018-27288040 TACAGGCATGAGCCACCACTTGG + Intergenic
1145928273 17:28664363-28664385 TACAGGCGTGTCGCCACGCCCGG - Intronic
1146048023 17:29526554-29526576 TACAGGCATGCACCACCACCTGG + Intronic
1146139862 17:30356317-30356339 TACAGGCATGAGCCCATGCCTGG + Intergenic
1146203313 17:30879881-30879903 TACAGGCGTGATACCACACCTGG - Intronic
1146606573 17:34263583-34263605 TACAGGCACGCGCCACCACCCGG + Intergenic
1146652811 17:34616835-34616857 CACAGGCATGTCCCCACCCCAGG - Intronic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1147812330 17:43181523-43181545 TACAGGCACCCGCCCACGCCCGG - Intronic
1149287783 17:55185144-55185166 TACAGGCATGAACCACCACCTGG + Intergenic
1149426194 17:56557130-56557152 TACAGGTATGCCACCACACCTGG - Intergenic
1149789395 17:59464017-59464039 TACAGGCATGCGCCACCACCTGG - Intergenic
1150019138 17:61593097-61593119 TACAGGCATGCCACCACACTCGG - Intergenic
1150345358 17:64400398-64400420 TATAGGCATGTGCCACCGCCCGG - Intronic
1150441143 17:65192471-65192493 CACGGGCATGTGCCACCACCTGG - Intronic
1150554016 17:66237474-66237496 TACAGGCATGCCAGCACACCTGG + Intronic
1150712723 17:67545433-67545455 TACAGGCATGCCACCACACCTGG - Intronic
1150777068 17:68089723-68089745 TACAGGCATGCGCCGCCACCTGG + Intergenic
1150885266 17:69078339-69078361 TACAGGCAAATGCCAACGCCCGG + Intergenic
1151234512 17:72709434-72709456 TTGAGGCAGGTGTCCACACCTGG - Intronic
1151458077 17:74238537-74238559 TACAGGCATACAACCACACCTGG + Intronic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151520937 17:74629063-74629085 TACAGGCGTGTGCTACCACCAGG - Intergenic
1151575189 17:74949627-74949649 GGCAGGCATGTGCCCAGGCCTGG - Exonic
1151806982 17:76411824-76411846 TACAGGCACATGCCACCACCCGG + Intronic
1152175701 17:78785800-78785822 TACAGGCATGAGCCTGCTCCTGG + Intergenic
1152664889 17:81562089-81562111 TACAGGCGTGCACCCACGCCTGG - Intronic
1153255131 18:3162748-3162770 TACAGGCGTGAGCCCACGCCCGG - Intronic
1153280179 18:3407577-3407599 TACAGGCATGAGCCCACGCCTGG - Intergenic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1154307458 18:13241068-13241090 TACAGGCATGTGCCACTACCCGG + Intronic
1155323624 18:24644082-24644104 TACAGGCATGTGCCACCATGCGG + Intergenic
1156298578 18:35815621-35815643 TATAAGCATGTGACCACACCAGG + Intergenic
1158356772 18:56629921-56629943 TACAGGCATGAGCCATCATCGGG - Intronic
1158988196 18:62841028-62841050 TAAAGGCATGTGCACATGCCTGG + Intronic
1158999430 18:62958062-62958084 TACAGGCTTGCGCCACCACCTGG + Intronic
1159762651 18:72448062-72448084 TACAGGCACATGCCCACATTCGG + Intergenic
1160169703 18:76543097-76543119 TATAGGCGTGAGCCCGCACCTGG - Intergenic
1160203381 18:76813463-76813485 TACAGGCATGAGCCAACATCCGG + Intronic
1160797078 19:950525-950547 TACAGCCATCTGTACACACCTGG - Intronic
1160803503 19:980901-980923 TACAGGCATGAGCCACCGCCTGG - Intergenic
1160893023 19:1389347-1389369 CACATGCATGTGTCCACACAAGG - Intronic
1160932897 19:1578906-1578928 TACAGGCATGAGCCTCTACCTGG - Intronic
1161095116 19:2385708-2385730 TACAGGCATGCCACCACACCCGG - Intergenic
1161137173 19:2626627-2626649 TGAAAGCAGGTGCCCACACCAGG - Intronic
1161217501 19:3101676-3101698 TCCAGGCCAGTGCCCACAACTGG + Intronic
1161289638 19:3486247-3486269 TACAGACATGAGCCACCACCTGG - Intergenic
1161348030 19:3777686-3777708 TGCAGGCATGTGGCCACAGGAGG + Intergenic
1161528401 19:4771651-4771673 TACAGGCATGTGTCAACTCACGG - Intergenic
1161624960 19:5320984-5321006 TACAGGCATGAGCCAGCACCGGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1161727894 19:5940983-5941005 TCCAGGCCTGTGCTCAGACCAGG + Intronic
1161764291 19:6198087-6198109 TACAGGCATGACCCCACGTCTGG + Intronic
1162024353 19:7885178-7885200 TACAGGCATGCGCCACCACTCGG - Intergenic
1162047126 19:8007451-8007473 TACAGGCATGAGCCACCACCCGG + Intronic
1162048958 19:8020636-8020658 TACAGGCATGTGCCACCATGCGG + Intronic
1162289174 19:9765791-9765813 TACAGGCATGAGCCACCCCCTGG - Intronic
1162338240 19:10074901-10074923 TACAGGCAAATCACCACACCTGG - Intergenic
1162447479 19:10732323-10732345 TACAGGCATGAGCCACCGCCCGG - Intronic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1162692132 19:12441519-12441541 TACAGGCACGCGCCACCACCCGG + Intronic
1163041365 19:14605236-14605258 TACAGGCATGACACCACGCCTGG + Intronic
1163072285 19:14854281-14854303 TACAGGCATGTGCCACCATGCGG + Intergenic
1163771640 19:19194664-19194686 TATAGGCATGCAACCACACCTGG + Intronic
1163794042 19:19325752-19325774 TACAGGCATGCCACCACACCCGG + Intronic
1164641340 19:29828243-29828265 TACAGGCACCTGCCCATGCCCGG + Intergenic
1164719411 19:30421503-30421525 TACAGGCATGCCACCACGCCTGG + Intronic
1164836691 19:31359564-31359586 TACAGGCATGAGCCACCACAGGG - Intergenic
1165074548 19:33273611-33273633 CACAGGGACGTGCCCACACACGG - Intergenic
1165182078 19:33980002-33980024 TACAGGCATGAGCCACCGCCTGG - Intergenic
1165251447 19:34539699-34539721 TGCAGGCATATGCCTACACCTGG + Intergenic
1165706699 19:37981281-37981303 TACAGTCACGTGCCACCACCTGG - Intronic
1165860185 19:38905321-38905343 CACAGGCGTGTGCCCCCACACGG - Exonic
1166040818 19:40201631-40201653 TACAGGCATGCCACCACACCAGG + Intronic
1166129348 19:40736778-40736800 TATAGGCATGATCCCACACCTGG + Intronic
1166352363 19:42205805-42205827 TACAGGCATGAGCCACCGCCTGG - Intronic
1166382025 19:42359827-42359849 TACAGGCATGCCACCACGCCTGG + Intronic
1166395594 19:42438081-42438103 TACAGGTGTGAGCCCCCACCTGG - Intronic
1166767092 19:45258124-45258146 TACAGGCGTGTGCCAATGCCTGG + Intronic
1167094652 19:47368178-47368200 AGCAGGCATGTGCCCCCACAGGG - Intronic
1167181376 19:47906702-47906724 AGCAGGCATGTGCCCCCACTGGG + Intergenic
1167182040 19:47912078-47912100 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167182693 19:47917451-47917473 AGCAGGCATGTGCCCCCACTGGG + Intergenic
1167183362 19:47922802-47922824 AGCAGGCATGTGCCCCCACTGGG + Intergenic
1167184006 19:47927846-47927868 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167184658 19:47933204-47933226 AGCAGGCATGTGCCCCCACTGGG + Intergenic
1167185329 19:47938559-47938581 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167185983 19:47943945-47943967 AGCAGGCATGTGCCCCCACTGGG + Intergenic
1167186647 19:47949316-47949338 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167187298 19:47954704-47954726 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167404825 19:49299276-49299298 TACAGGCATGAGCCCGCTTCTGG - Intronic
1167541891 19:50093560-50093582 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167543871 19:50108095-50108117 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167544545 19:50113449-50113471 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167545220 19:50118799-50118821 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167545897 19:50124151-50124173 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167546574 19:50129486-50129508 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167547234 19:50134820-50134842 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167905620 19:52658267-52658289 TACAGGCATGAGCCAGAACCTGG - Intronic
1168607327 19:57770295-57770317 TACAGGCATGCGCCACCACGGGG + Intronic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
1202699474 1_KI270712v1_random:153334-153356 TACAGGCTTGCCACCACACCTGG + Intergenic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
926342868 2:11918939-11918961 TACAGGCATGTCACCATGCCCGG + Intergenic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
927084760 2:19663659-19663681 TGCAGGCATGCCACCACACCCGG + Intergenic
927170250 2:20363243-20363265 TACAGGCATGAGCCACCCCCGGG - Intergenic
927661721 2:24998923-24998945 TACAGGCACCTGCCACCACCTGG - Intergenic
927781681 2:25944489-25944511 TACAGGCATGTGCTAATGCCTGG + Intronic
927891513 2:26753265-26753287 CACAGGCGTGTGCCCATGCCTGG + Intergenic
927977298 2:27348526-27348548 TACAGGCATGAGCCTGTACCTGG - Intronic
928501974 2:31906110-31906132 TACAGGCACACACCCACACCTGG + Intronic
929095259 2:38257667-38257689 TACAGGCATGCCACCACGCCTGG - Intergenic
929157364 2:38800042-38800064 TACAGGCATACGCCACCACCCGG - Intronic
929741295 2:44603364-44603386 TACAGGCATGAGCCACCAACTGG + Intronic
930087432 2:47507733-47507755 TACAGGCGTGAGCCTCCACCTGG + Intronic
931431327 2:62211211-62211233 TACAGGCATGTCACCACACCTGG - Intronic
931803031 2:65777321-65777343 TACAGGCGTGTGCTACCACCTGG + Intergenic
931996595 2:67844524-67844546 CACAGTCATGTGCCCAAACACGG + Intergenic
932550394 2:72763936-72763958 TACAGGCATGCCACCACACCCGG - Intronic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
932726534 2:74184365-74184387 TACAGGCACATCACCACACCTGG - Intergenic
932735618 2:74252165-74252187 GACAGGAAGGTGCCCACCCCAGG - Exonic
932993538 2:76818481-76818503 TACAAGCATTTGCTCACTCCAGG - Intronic
933406015 2:81860516-81860538 TACAGGCATAAGCCCACACCTGG - Intergenic
934170422 2:89536824-89536846 TACAGGCTTGCCACCACACCTGG + Intergenic
934280724 2:91611144-91611166 TACAGGCTTGCCACCACACCTGG + Intergenic
934968289 2:98742451-98742473 TACAGGCACCTGACCACGCCCGG - Intergenic
935080533 2:99789157-99789179 TACAGGCATGGCACCGCACCTGG - Intronic
935547849 2:104419510-104419532 TACAGGCGTGAGCCAACGCCAGG - Intergenic
935627813 2:105185559-105185581 TGCAGGGGTGTGCCCACCCCTGG - Intergenic
935876865 2:107516802-107516824 TAAAAGCACGTGCTCACACCAGG - Intergenic
937270251 2:120645355-120645377 TACAGGCTTGAGCCCACACCCGG + Intergenic
938118640 2:128618831-128618853 CACATGCATGTGCACACACACGG + Intergenic
938241731 2:129747613-129747635 TGCAGGCATTTTCCCAGACCTGG + Intergenic
938297563 2:130187901-130187923 TACAAGCATGGGGCCACACCTGG - Intronic
938459207 2:131486763-131486785 TACAAGCATGGGGCCACACCTGG + Intronic
938494092 2:131783106-131783128 TGCAGGCATTTCCCCAGACCTGG - Intergenic
938829606 2:135037271-135037293 TACAGGCGTGAGCCATCACCTGG + Intronic
938845603 2:135205624-135205646 TACAGGTATGAGCCAACGCCTGG + Intronic
939902646 2:147868770-147868792 CACAGGCATGCCACCACACCTGG + Intronic
940207702 2:151222403-151222425 TACAGGTGTGAGCCCACGCCTGG + Intergenic
940610481 2:155984755-155984777 TACAGACATGCCACCACACCTGG + Intergenic
941321667 2:164063257-164063279 TACAGGCATGTGCCACCACACGG + Intergenic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
943027087 2:182642965-182642987 GACAGGCATGTGCCCAAGCATGG + Intergenic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
943645470 2:190405057-190405079 TATAGGCATGCCACCACACCTGG + Intergenic
944062553 2:195584375-195584397 TACAGGCATGCCACCGCACCCGG + Intronic
944302482 2:198139473-198139495 TACAGGCATCTGCCTACTTCAGG + Intronic
945303990 2:208241363-208241385 TATAGGCATGCGACCACACCTGG + Intronic
946210106 2:218140758-218140780 TACAGGCGTGAGCCCACACCTGG - Intergenic
946663557 2:222026800-222026822 CACAGGTATGTCACCACACCTGG - Intergenic
947230398 2:227878926-227878948 TACAGGCATGCCACCACACTTGG + Intronic
947688154 2:232109168-232109190 TACAGGCATGAGCCACCGCCTGG - Intronic
948005424 2:234604102-234604124 TACAGGCATGAGCCAAAAACTGG - Intergenic
948108562 2:235435367-235435389 CACAGGAAGGTGCCAACACCAGG - Intergenic
948406070 2:237720523-237720545 TACAGGCATGACACCACACCTGG + Intronic
948515325 2:238499928-238499950 CACACGCATGTGCCCAGTCCTGG + Intergenic
948828290 2:240584947-240584969 TACAGGCATGGGCCCAGCCTTGG + Intergenic
1169184458 20:3602686-3602708 TACAGGCATGAGCCACCGCCCGG - Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1169485662 20:6029500-6029522 TACAGGCATGCCACCACACCTGG + Intronic
1169678407 20:8181106-8181128 TACAGGCATGCCACCACGCCTGG - Intronic
1170363507 20:15574142-15574164 TCCAAGCATGTGCAGACACCAGG + Intronic
1170587025 20:17742553-17742575 TATAGGCATGAGCCGTCACCCGG - Intergenic
1170777165 20:19385910-19385932 TACAGGCATGAGCCACCACCTGG + Intronic
1171544998 20:25993330-25993352 TACAGGCATGATCCAGCACCTGG - Intergenic
1171967193 20:31539518-31539540 TACAGGCATGAGCCACCACCTGG - Intronic
1171997750 20:31745468-31745490 TACAGGCACGCCACCACACCTGG + Intronic
1172391642 20:34569061-34569083 TACAGGCACACCCCCACACCTGG - Intronic
1172723923 20:37021716-37021738 TACAGGCATGAGCCTGCGCCCGG + Intronic
1172796525 20:37543226-37543248 TACTGGCATGTGCTGACACCTGG - Intergenic
1172865479 20:38093593-38093615 TACAGGCATCTACCCACGCCTGG + Intronic
1173791689 20:45832167-45832189 TACAGGCATGTGCCACCATGCGG - Intronic
1173907594 20:46640220-46640242 TACAAGAAAGTGCCGACACCTGG - Intronic
1174410429 20:50331515-50331537 CACAGTCCTGTGGCCACACCCGG + Intergenic
1174781491 20:53393103-53393125 TACAGGCAAGCCACCACACCTGG + Intronic
1174896744 20:54457504-54457526 TACAGGCGTGAGCCCATGCCTGG - Intergenic
1175829460 20:61954090-61954112 TACAGGCATGCACCACCACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176613823 21:9011261-9011283 TGCAGGCATTTCCCCAGACCTGG + Intergenic
1176711371 21:10152628-10152650 TGCAGGCATTTCCCCAGACCTGG - Intergenic
1176905664 21:14497450-14497472 TATAGGCATGCCACCACACCCGG - Intronic
1177594206 21:23214080-23214102 TTCAGGCAGTTCCCCACACCTGG + Intergenic
1178827360 21:36028045-36028067 TACAGGCATGCGCCAAGAGCTGG - Intergenic
1178879059 21:36434177-36434199 TACAGGCATGAGCCACCACCCGG + Intergenic
1180682778 22:17639993-17640015 TACAGGCATGCGCCACCACGCGG + Intronic
1181087110 22:20445902-20445924 TACAGGCATGCAACCACACCTGG + Intronic
1181160265 22:20956074-20956096 TACAGGCATGAGCCACCACCTGG + Intergenic
1181867729 22:25872622-25872644 TACAAGCAAGTGGCAACACCAGG - Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1182216655 22:28724130-28724152 TACAGGCGTGAGCCCCCGCCTGG - Intronic
1183554819 22:38516963-38516985 TACAGACATGCCACCACACCTGG + Intergenic
1183715067 22:39528695-39528717 GACAGGCATTTGACCCCACCTGG + Intergenic
1183755308 22:39756473-39756495 TACAGGCATGTCACCACACCTGG + Intronic
1183779193 22:39988039-39988061 TACAGGCATGCCACCACGCCAGG - Intergenic
1183932411 22:41243286-41243308 TACAGGTGTGAGCCCGCACCCGG + Intergenic
1184014973 22:41779047-41779069 TACAGGCATGAGCACCCCCCTGG - Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184261450 22:43319420-43319442 TACAGGCGTGCCACCACACCTGG - Intronic
1184566648 22:45296016-45296038 TACAGGCATGTGCCACTGCCTGG - Intergenic
1184627707 22:45750233-45750255 TAGAGGTATGTCACCACACCTGG + Intronic
1184752363 22:46494647-46494669 TACAGGCATGCCACCACGCCTGG + Intronic
1185013122 22:48327371-48327393 TACAGGCGTGTCATCACACCTGG - Intergenic
1185367322 22:50442688-50442710 TACAGGCATCCGCCACCACCAGG + Intronic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
949410462 3:3757746-3757768 TACAGGCATGAGCCACCACGTGG + Intronic
950353303 3:12379145-12379167 TACAGGCGTGCTACCACACCCGG + Intronic
950809883 3:15641177-15641199 TAAAGGCCTTTTCCCACACCTGG - Intronic
951245183 3:20332272-20332294 TACAGGCATGAGCCACCGCCTGG + Intergenic
952142303 3:30493613-30493635 TACAGGCGTGAGCCGCCACCTGG + Intergenic
952397974 3:32937937-32937959 TACAGGCATGCCACCACGCCCGG + Intergenic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
952763662 3:36936957-36936979 TACAGACATGTGCCCATGCCTGG - Intronic
953729537 3:45435107-45435129 TACAGGCATGTATCCCCACAGGG + Intronic
953759538 3:45675729-45675751 TACAGGCATGGGCCCATGCCTGG - Intronic
953778413 3:45842970-45842992 TGCAGGCATTTGCCCACAGAAGG + Intronic
954238491 3:49275360-49275382 TACAGGCGTGCCACCACACCCGG + Intronic
954544697 3:51423214-51423236 TACAGGCATGAGACCACGCCTGG - Intronic
954937564 3:54340837-54340859 TTCAGCCTTGTGCTCACACCTGG - Intronic
955284342 3:57624423-57624445 TACAGGCGTGAGCCCATGCCCGG + Intergenic
955290930 3:57692085-57692107 TACAGGCATGCGACCATGCCCGG - Intronic
957376874 3:79370215-79370237 TACAGGCACATGCCCACTCCTGG - Intronic
958156564 3:89762447-89762469 TGCAGGCATTTTCCCACACCAGG - Intergenic
958734709 3:97995117-97995139 TACAGGCATGCACCACCACCTGG + Intronic
958852816 3:99349498-99349520 TACAGGCACATACCCACATCTGG - Intergenic
959383569 3:105673342-105673364 TACAGGCATGAGCCTGTACCTGG + Intronic
959527319 3:107391602-107391624 TACAGGCATGAGCCACCACCAGG + Intergenic
959904107 3:111691950-111691972 TTCAGGCAAGAGCCCCCACCAGG + Intronic
960312290 3:116131406-116131428 TACAGGCATGTGACCCAATCAGG + Intronic
960315311 3:116168923-116168945 TACAGGCATGTGCCTAGCCCTGG - Intronic
961084274 3:124053175-124053197 TCCAGGCATATGCCCACCTCTGG + Intergenic
961474566 3:127138577-127138599 TACAGGCCTGTGCCCATGGCTGG + Intergenic
961811472 3:129524202-129524224 TACAGGCATGCCACCACACCTGG - Intergenic
961826721 3:129603119-129603141 CACTGGCCTGTGCCCACAGCGGG + Intronic
962009456 3:131380253-131380275 TATAGGTATGTGCCCAGCCCTGG + Intergenic
962265971 3:133944614-133944636 GCCAGCCATGTGGCCACACCTGG + Intronic
962584320 3:136826310-136826332 TACAGGCATGAGCCACCACGAGG + Intronic
963238111 3:142975122-142975144 TACAGGCAAGTGCCACCACCTGG - Intronic
964018088 3:151972430-151972452 TACAGGCACATGCCCATACCTGG + Intergenic
964112583 3:153103092-153103114 TACAGGCATGCCTCCACGCCCGG + Intergenic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965220593 3:165921552-165921574 TACAGGCATCAGCACACTCCAGG - Intergenic
965295715 3:166943128-166943150 TACAGGCATGCGCCACCAGCAGG - Intergenic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
965558002 3:170037600-170037622 TACAGGCATGAGCCACCGCCTGG + Intergenic
965588811 3:170343233-170343255 TACAGGCATGCCACCACACCCGG + Intergenic
965952812 3:174331447-174331469 TACAGGCACATGCCACCACCTGG + Intergenic
965996775 3:174892779-174892801 TACAGGCACATGCCACCACCTGG - Intronic
966088764 3:176104480-176104502 TACAGGCACGTGCCACCACGCGG + Intergenic
966167044 3:177031472-177031494 TACAGACATGTCACCACACCTGG + Intronic
966568240 3:181408009-181408031 TACAGGCATGAGCCACCGCCAGG - Intergenic
966693759 3:182768028-182768050 TACAGGCACATGCCCCCACGCGG - Intergenic
966893547 3:184425834-184425856 TACAGGCACGTGCCACCACACGG + Intronic
968264995 3:197355967-197355989 TCCAGGCATGAGGCAACACCTGG - Intergenic
968322260 3:197780144-197780166 TACAGGCACACACCCACACCTGG + Intronic
969029378 4:4199046-4199068 TACAGGCTTGCCACCACACCTGG - Intronic
969059304 4:4422422-4422444 TACAGGCATGCCACCACGCCTGG - Intronic
969381895 4:6806457-6806479 TACAGGCATGAGCCACCGCCAGG - Intronic
969688837 4:8692463-8692485 TACAGGCATGCCACCACGCCCGG + Intergenic
969906085 4:10397073-10397095 TGCAGGCATTTTCCCAGACCAGG - Intergenic
970568686 4:17358010-17358032 TACAGGCACGCCACCACACCTGG + Intergenic
971421809 4:26480782-26480804 TACAGGCATGTGCTACCATCTGG - Intergenic
972454463 4:39239896-39239918 TACAGGCATGAGCCACCACTGGG - Intronic
972578549 4:40374581-40374603 TACAGGCACGAGCCCATGCCAGG - Intergenic
973174185 4:47184098-47184120 TAAAGGCTAGTGACCACACCTGG + Intronic
973220047 4:47715462-47715484 TACAGGCATCTGCCACCACACGG - Intronic
973325029 4:48851531-48851553 TACAGGCATGCGCCACCACTTGG - Intronic
973666507 4:53164649-53164671 TACAGGCATGCCACCACACCCGG - Intronic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
976621279 4:87130113-87130135 TACAGGCCTGCTACCACACCTGG + Intronic
976731211 4:88263811-88263833 TACATGCATGCCACCACACCTGG + Intronic
977712992 4:100148915-100148937 TGGAGCCATGTGCCCACTCCTGG + Intergenic
978350404 4:107815421-107815443 AACAGACTGGTGCCCACACCAGG - Intergenic
978515493 4:109564270-109564292 TACAGGCATGTGCCACCATGGGG + Intronic
979020736 4:115493971-115493993 TACAGGCATGTCACCACGCCTGG + Intergenic
980041466 4:127945456-127945478 TACAGGCATGTGCCACCACGTGG + Intronic
980812182 4:137896212-137896234 TACAGGCATGAGCCATCACGCGG - Intergenic
981232172 4:142369433-142369455 TACAGGCATGCCACCACGCCTGG - Intronic
981232660 4:142375851-142375873 TAACAGCAAGTGCCCACACCTGG + Intronic
981547099 4:145904564-145904586 GCCAGGCATGTTCCCACAGCAGG - Intronic
981947476 4:150365147-150365169 TACAAGCATGCCACCACACCCGG + Intronic
982010052 4:151097882-151097904 TACAGGCATGAGCCACCACCTGG + Intergenic
982528620 4:156509694-156509716 TACAGGCATGTGCCACCACACGG - Intergenic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
983670932 4:170237088-170237110 TATAGGCACGTGCCACCACCCGG - Intergenic
983796348 4:171868820-171868842 TACAGGCGTGGGCCCCCACCTGG + Intronic
983894484 4:173067738-173067760 TACAGACATTTGCCAGCACCAGG - Intergenic
984640789 4:182162157-182162179 TACAGGCAAGCTACCACACCTGG + Intronic
985876607 5:2603485-2603507 TGCAGGCAGAAGCCCACACCAGG - Intergenic
988307320 5:29509348-29509370 GAGAGGCATGTGCCAACTCCGGG - Intergenic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
990404506 5:55475079-55475101 TACAGGCATGTCACCATGCCTGG + Intronic
990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG + Intergenic
991661175 5:68952169-68952191 TACAGGCATGCCACCACACCAGG + Intergenic
991720117 5:69487485-69487507 TACAGGCACGCACCCACAACTGG - Intergenic
992707716 5:79414221-79414243 TACAGGCATGCAACCATACCTGG + Intronic
993705356 5:91163305-91163327 GACAGGCATGTGAGAACACCTGG - Intronic
995043683 5:107619601-107619623 TACAGGCATGCTACCATACCCGG + Intronic
996719991 5:126620876-126620898 TACAGGCATACCACCACACCCGG + Intronic
997118958 5:131154812-131154834 TACAGGCGTGAGCCCACACCTGG + Intergenic
997169776 5:131705330-131705352 TACAGGCTTGCCACCACACCTGG - Intronic
997486302 5:134233866-134233888 TACAAGCGTGTGACCCCACCTGG + Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998376696 5:141695600-141695622 TACAGGCACATTCCCAAACCAGG + Intergenic
998448329 5:142215565-142215587 TACAGGCATGCTACAACACCTGG - Intergenic
998469010 5:142368786-142368808 TACAAGCATGTCACCACACCTGG + Intergenic
998474305 5:142407762-142407784 TACAGGCATACCACCACACCTGG - Intergenic
998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG + Intergenic
999199273 5:149804529-149804551 TACAGGCATGCTCCACCACCTGG - Intronic
999449393 5:151666881-151666903 TGCAGGCATGCTACCACACCTGG - Intronic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
999483263 5:151968156-151968178 CACACGCATGTGCACACACACGG + Intergenic
999899825 5:156074537-156074559 TACAGGCATGCCACCACGCCCGG - Intronic
1000001180 5:157140682-157140704 TACAGGCATGTCACCAAGCCCGG + Intronic
1000102546 5:158030486-158030508 TACAGGCGCGTCACCACACCTGG + Intergenic
1000771252 5:165357837-165357859 TACAGGCGTGTGCTACCACCCGG + Intergenic
1000924785 5:167180248-167180270 TACAGGCATGTGCCACCACACGG + Intergenic
1001084387 5:168690275-168690297 TGCAGGAGTGTGCCCACACCTGG + Intronic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001391670 5:171384501-171384523 TACAGGCATGCCACCACGCCTGG + Intergenic
1001502165 5:172245569-172245591 TACAGGCATGCGCCACCACGTGG - Intronic
1001630673 5:173172919-173172941 TACAGGCGTGCCCCCACGCCTGG - Intergenic
1001873330 5:175177454-175177476 TACAGGCATGCCACCACACCTGG - Intergenic
1003334193 6:5155220-5155242 TACAGGCATGCGCCACCGCCTGG + Intronic
1004225533 6:13781189-13781211 TACAGGCTTGCCACCACACCTGG - Intergenic
1005620475 6:27615320-27615342 TACAGGCATGAGCCACCACCCGG + Intergenic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006367387 6:33623466-33623488 TACAGGCACATCACCACACCCGG + Intronic
1006440390 6:34050154-34050176 GCCAGGCATGAGCCCACCCCAGG + Intronic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1006697839 6:35946509-35946531 TACAGGCGTGAGGCCACACCTGG + Intronic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1006940089 6:37746265-37746287 TACAGGCCTGACACCACACCTGG + Intergenic
1007002791 6:38330193-38330215 TACAGGCGTGCCACCACACCTGG + Intronic
1007007293 6:38377577-38377599 TACAGGCATGCACACACACACGG + Intronic
1007458697 6:42000840-42000862 TACAGGCATGCCACCACGCCTGG + Intronic
1007533370 6:42563198-42563220 TACAGGCGTGCCACCACACCTGG + Intergenic
1007549340 6:42717080-42717102 TACAAGCATGAGCCCGCACCTGG + Intronic
1007610899 6:43148110-43148132 TACAGGCATGCCCCCACGCCCGG - Intronic
1007643481 6:43362645-43362667 TACAGGCATGCGCCACCACTGGG + Intronic
1007930848 6:45689270-45689292 TACAGGCATGCCACCACACCTGG + Intergenic
1008330162 6:50235743-50235765 TACAGGCATGTGCCACCACACGG - Intergenic
1008651792 6:53571017-53571039 TACAGGTGTGAGCCCGCACCCGG + Intronic
1010057870 6:71586565-71586587 TACAGGCACATCACCACACCTGG + Intergenic
1010872947 6:81064259-81064281 CACAGTCATGTGCCGCCACCAGG + Intergenic
1010948353 6:82005348-82005370 TACAGAAATTTTCCCACACCTGG + Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1011531986 6:88332821-88332843 TACAGGCATGCTACCACGCCTGG - Intergenic
1011590650 6:88967133-88967155 TACAGGCACGTCACCACACCTGG - Intergenic
1011878059 6:91986967-91986989 TACAGACACGTGCCAACACATGG + Intergenic
1012957919 6:105590709-105590731 TACAGGCATGTGCCCATGCTTGG - Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013083800 6:106837611-106837633 TGCAGGCATGTACCACCACCTGG + Intergenic
1013129013 6:107213614-107213636 TACAGGCACCTGCCACCACCCGG - Intronic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1013315441 6:108937833-108937855 TACAGGCGTGCCACCACACCTGG + Intronic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1014043445 6:116855728-116855750 TACAGGCATGAGCCACCACACGG - Intergenic
1014322112 6:119942885-119942907 TACAGGCAATTTCCCAGACCTGG - Intergenic
1014456363 6:121639278-121639300 TACAGGCATGCCACCACGCCAGG - Intergenic
1014578689 6:123107457-123107479 TACAGGCATTTTCCCACACCTGG - Intergenic
1015838682 6:137451833-137451855 TACAGGCATATGCCACCGCCTGG + Intergenic
1017048056 6:150365489-150365511 CATAGGCCTTTGCCCACACCTGG + Intergenic
1017110998 6:150932625-150932647 TACAGGCACGTCATCACACCTGG - Intronic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1017713938 6:157194842-157194864 TACAGGCATGAGTCATCACCTGG - Intronic
1017753128 6:157507422-157507444 TACAGGCACGCCACCACACCTGG + Intronic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1019004012 6:168781034-168781056 TACAGGCATGAGCCACCAACTGG + Intergenic
1019278427 7:188132-188154 TACAGGCATCTGCGCTCACCAGG + Intergenic
1019380134 7:717146-717168 TACAGGCACGGCACCACACCTGG - Intronic
1019451844 7:1102945-1102967 TACAGGGAGGTGGGCACACCAGG + Intronic
1019757118 7:2779205-2779227 TACAGGCATGCCACCACATCAGG - Intronic
1020202930 7:6094312-6094334 TACAGGCATGCACCAGCACCTGG + Intergenic
1020619317 7:10498691-10498713 TACAGGCATGAGCCAGCGCCGGG - Intergenic
1021665134 7:22969439-22969461 TACAGGCATGAGCCAACGTCTGG + Intronic
1021742289 7:23699256-23699278 TACAGGTGTGCCCCCACACCTGG + Intronic
1022128449 7:27380102-27380124 TTCTGGAATGTGTCCACACCAGG + Intergenic
1022315151 7:29238822-29238844 TCCAGGCATGTTCCCACCTCAGG - Intronic
1023872665 7:44271192-44271214 TACAGGCATGAGCCACCATCTGG + Intronic
1023974842 7:45021113-45021135 TACAGGCATGTCGCCACACCTGG - Intronic
1024773168 7:52749674-52749696 TACAGGCATGCCATCACACCTGG + Intergenic
1024946223 7:54809742-54809764 TACAGGCATGACCCCACACCTGG + Intergenic
1025296406 7:57778395-57778417 TACAGGCGTGAGCCAGCACCTGG - Intergenic
1025946021 7:66105212-66105234 TATAGGCACGTGCCAACAACCGG - Intronic
1026066359 7:67076913-67076935 TACAGGCTCGTGCCACCACCTGG + Intronic
1026409515 7:70105531-70105553 TACAGGCATAAGCACATACCCGG + Intronic
1027364869 7:77446922-77446944 TACAGGCATGAGCCACCGCCTGG + Intergenic
1028941658 7:96528332-96528354 TACAGGCGTGCCACCACACCTGG + Intronic
1029422808 7:100479743-100479765 TACAGGCATGAGCCACCACCGGG - Intergenic
1029455065 7:100665695-100665717 TACAGGCATGCCACCAAACCTGG + Intergenic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1030142169 7:106316272-106316294 TACAGGCATGAGCCACCACCTGG - Intergenic
1031593961 7:123626329-123626351 TGCAGGCATGTGCCACCACAGGG - Intronic
1031611788 7:123836751-123836773 TACAGGCATGAGCCACCACCTGG - Intronic
1031873976 7:127117346-127117368 TACATGCATCTGTCCACCCCTGG + Intronic
1032018439 7:128393808-128393830 TGCAGGCATGTGCCCCACCCTGG - Intronic
1032131719 7:129234516-129234538 TACAGGCGCGAGCCCACACCTGG + Intronic
1032145342 7:129374664-129374686 TACAGGCATGTGCCACCACGCGG - Intronic
1032425222 7:131817272-131817294 TACAGGCATGCCACCATACCTGG - Intergenic
1032748129 7:134808381-134808403 TACAGGCATGAGCCACCACCTGG + Intronic
1033292210 7:140095734-140095756 TAGATGCATGTCACCACACCTGG - Intronic
1033322893 7:140356404-140356426 TACAGGCGTGAGCCCTCGCCTGG - Intronic
1033928888 7:146499321-146499343 AACAGGCATGCCACCACACCTGG + Intronic
1034137575 7:148785497-148785519 TACAGGCGTGCCACCACACCCGG + Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1035124212 7:156596155-156596177 TACAGGCATAAGCCCACACTCGG + Intergenic
1035845450 8:2859436-2859458 CTCAGGCAGGTGCCCAGACCTGG + Intergenic
1036932309 8:12968158-12968180 TACAGACATGAGCCACCACCTGG + Intronic
1037056823 8:14452822-14452844 TACAGGCGTGAGTCCACACCCGG - Intronic
1037099381 8:15024659-15024681 TACAGGCTTGAGCCACCACCCGG - Intronic
1037446349 8:18970048-18970070 TACAGGTGTGAGCCCGCACCTGG - Intronic
1037912156 8:22749945-22749967 TACAGGCATGTGCCACCATGTGG + Intronic
1038013207 8:23491205-23491227 TACAGGCGAGTGCCAACGCCCGG + Intergenic
1038634853 8:29277508-29277530 TACAGGCATGAGCCACCACCTGG + Intergenic
1038769039 8:30459102-30459124 TACAGGCGTGCCACCACACCCGG + Intronic
1038881462 8:31618304-31618326 TACGGGCATGACACCACACCCGG - Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039252196 8:35679107-35679129 TACAGGTATGTCACCACACCAGG - Intronic
1039736084 8:40334427-40334449 TACAGGCATCTGCCAAAGCCCGG - Intergenic
1039920077 8:41887389-41887411 TACAGGCATGCCACCACACCTGG + Intronic
1040057283 8:43070109-43070131 TACAGGCACGCCACCACACCCGG - Intronic
1040593277 8:48815753-48815775 TACAGGCACGTGCCACCACGTGG - Intergenic
1041670278 8:60484841-60484863 TACAGGCATGCCACTACACCTGG - Intergenic
1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG + Intergenic
1042386174 8:68177422-68177444 TATAGGCATGTGCCCCCATGGGG - Intronic
1042395267 8:68284976-68284998 TACAAGCATGTGCCACCACGCGG - Intergenic
1042511404 8:69616358-69616380 TATAGGCATGCGCCGCCACCTGG + Intronic
1042830317 8:73019668-73019690 TACAGGCACACGCCCCCACCTGG + Intronic
1042999894 8:74745125-74745147 TACAGGCTCCTGACCACACCTGG - Intronic
1043097191 8:75990099-75990121 TACAGGCATGAGCCACCACCTGG - Intergenic
1043443777 8:80299845-80299867 TACAGGCATGAGCCTGCGCCCGG + Intergenic
1043610790 8:82060463-82060485 TGCAGGCATTTTCCCAGACCTGG - Intergenic
1044152399 8:88797593-88797615 TTCAGGCATGCCACCACACCTGG - Intergenic
1044308670 8:90666792-90666814 TGCAGGCATTTTCCCAGACCCGG - Intronic
1044531412 8:93311687-93311709 TACAGCCATGTTCTAACACCCGG - Intergenic
1044549611 8:93497005-93497027 TACAGGCATGCCACCACGCCCGG + Intergenic
1045134271 8:99196578-99196600 TATAGGCACGTCACCACACCTGG + Intronic
1045225865 8:100245046-100245068 TACAGGCACCTGCCACCACCCGG + Intronic
1045530744 8:102982996-102983018 TACAGGCATGTACCACCATCTGG - Intergenic
1045625843 8:104049276-104049298 TACAGGCACACGCCCACCCCGGG - Intronic
1045932501 8:107643451-107643473 TACAGGCACGCCACCACACCTGG - Intergenic
1046141347 8:110096979-110097001 AACAGGCATATCACCACACCTGG + Intergenic
1046226742 8:111291588-111291610 TACAGGCATGACACCACATCTGG + Intergenic
1046627383 8:116589621-116589643 TACAGGCGTGTGCTAACTCCTGG - Intergenic
1046928683 8:119821759-119821781 TACAGGCGTGAGCCCATGCCTGG - Intronic
1047323068 8:123807366-123807388 TACAGGCATGAGCCTGTACCTGG - Intronic
1047412950 8:124639059-124639081 TACAGGCATGAGCCACCACCTGG - Intronic
1047529657 8:125663515-125663537 TACAGGCACGTGCCCATGCCAGG - Intergenic
1047736325 8:127768348-127768370 TACAGGCACGCCCCCACGCCAGG + Intergenic
1049018137 8:139936025-139936047 TCCAGGCCTGTGCTCGCACCAGG - Intronic
1049095609 8:140546469-140546491 CACAGGCCTGTGCACACAGCAGG + Intronic
1050054244 9:1635292-1635314 TACCTGCATGTGCACACACATGG + Intergenic
1050110203 9:2207612-2207634 TACAGGCATGCGCCACCACATGG + Intergenic
1050536081 9:6631923-6631945 TACAGGCATGTGCTACCACATGG - Intronic
1050760749 9:9067100-9067122 TACAGTCATGTGCCACCACGAGG - Intronic
1050767295 9:9150747-9150769 TACAGGCATGAGCCAACAACCGG + Intronic
1051274811 9:15388496-15388518 TACAGGCATGTGCCATTGCCTGG - Intergenic
1051340720 9:16107288-16107310 CACAGGCATGTGACCATGCCTGG + Intergenic
1051679047 9:19588683-19588705 TACAGGCATGAGCCACCACGCGG - Intronic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1053292949 9:36894082-36894104 TATAGGCATGTACCAAAACCAGG - Intronic
1053648358 9:40138319-40138341 TGCAGGCATTTACCCAGACCTGG - Intergenic
1054138248 9:61450651-61450673 TACAGGCGTGCCACCACACCTGG - Intergenic
1054329336 9:63736262-63736284 TGCAGGCATTTCCCCAGACCTGG - Intergenic
1054485557 9:65718145-65718167 TACAGGCTTGCGCCCATGCCTGG + Intronic
1054536222 9:66237851-66237873 TGCAGGCATTTACCCAGACCTGG + Intergenic
1055067781 9:72135884-72135906 TACAGGCATGAGCCACCACGCGG + Intronic
1055092978 9:72381352-72381374 TACAGGCATGTACCACCACATGG - Intergenic
1055573198 9:77637711-77637733 TACAGGCATGCTACCACACCCGG - Intronic
1055703988 9:78977981-78978003 TACAGGCGTGAGCCCGCATCCGG + Intergenic
1055771766 9:79724563-79724585 TACAGGCATGAGCCACCACGTGG - Intronic
1055818344 9:80232957-80232979 TGCAGGCATTTTCCCAGACCTGG - Intergenic
1056407603 9:86290564-86290586 TACAGGCATGAGCCACCGCCTGG - Intronic
1056531930 9:87496054-87496076 TACAGGCATGTGACTATGCCCGG - Intergenic
1057321670 9:94018943-94018965 TATAGGCATGTGCACACCCGAGG - Intergenic
1057340306 9:94195234-94195256 TACAGGCATGAGCCACCACATGG - Intergenic
1058378000 9:104347140-104347162 TACAGGCATGAGCCACCGCCCGG - Intergenic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1058966591 9:110044625-110044647 TACAGGCGTGCCACCACACCCGG + Intronic
1059181205 9:112214261-112214283 TACAGGCATGAGCCACCACCTGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1059684267 9:116619662-116619684 TACAGGCATGTGCCACCACACGG + Intronic
1059840479 9:118209803-118209825 TACAGGCAGGGTCCCAAACCAGG - Intergenic
1060274235 9:122170153-122170175 TACAGGCATGCCACCACACCCGG - Intronic
1060296307 9:122345783-122345805 TACAGGCATTAGCCACCACCTGG - Intergenic
1060629922 9:125146896-125146918 TACAGGCATTTTCCAAAACCTGG + Exonic
1060670548 9:125465777-125465799 TAGAGGCATGTGCAAACTCCTGG + Intronic
1060730895 9:126036355-126036377 TACAGGCATGAGCCCGCACCTGG - Intergenic
1060912295 9:127360809-127360831 TTCAGGCTTGTACCCACCCCGGG + Intronic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1061331073 9:129893639-129893661 TACAGGCATGAGCCCGTGCCTGG - Intronic
1061510632 9:131058920-131058942 TACAGGCATGAGCCCAAGTCTGG - Intronic
1061510658 9:131059053-131059075 TACAGGCACCTAACCACACCTGG - Intronic
1061547808 9:131314933-131314955 TACAGGCATGAGCCCGCTCCAGG + Intergenic
1061699612 9:132406162-132406184 TGCAGGTACGTGCCCAAACCTGG + Intronic
1062337157 9:136076731-136076753 TACAGGCATGAGCCACCACCAGG - Intronic
1062482280 9:136758060-136758082 TGCAGGCTTGTGCGCCCACCCGG + Exonic
1202796124 9_KI270719v1_random:121617-121639 TGCAGGCATTTCCCCAGACCTGG - Intergenic
1186083872 X:5964792-5964814 TACAGGCATATGCCACCACCTGG + Intronic
1186208976 X:7230161-7230183 TACAGACATGAGCCACCACCAGG + Intronic
1186240587 X:7561210-7561232 TACAGGCATGCAACCACACCAGG + Intergenic
1187342032 X:18429911-18429933 TACAGGCATGAGCCACCGCCAGG + Intronic
1187951940 X:24479642-24479664 TACAGGCACGTGCCACCGCCTGG - Intronic
1188315619 X:28669476-28669498 TACAGGCATGCGCCACCACAAGG - Intronic
1189450351 X:41123081-41123103 TCCAGGCTTGAGCCCTCACCAGG + Intronic
1189919673 X:45891195-45891217 CACAGGCATGCCACCACACCTGG + Intergenic
1190059450 X:47201484-47201506 TCCAGGCAGGTAACCACACCGGG - Exonic
1190311389 X:49119382-49119404 TACAGGCATGAGCCACTACCTGG + Intronic
1190315935 X:49151020-49151042 TACAGGCGTGTGCCACCGCCCGG + Intergenic
1190715182 X:53096990-53097012 TACAGGCATGTGCCACCATGTGG - Intergenic
1190772112 X:53523895-53523917 TACAGGCTTGTTACCACACCTGG - Intergenic
1192472514 X:71411355-71411377 TACAGGCATGAGCCACCACTAGG + Intronic
1192926188 X:75757967-75757989 CACAGGCATGTGCAGAGACCAGG + Intergenic
1193997479 X:88384383-88384405 TGCAGGCATTTTCCCAGACCTGG + Intergenic
1194128553 X:90050469-90050491 TACAGGCATGTCACCATGCCCGG - Intergenic
1194711912 X:97245686-97245708 TACAGGCATGAGCCCCCATGTGG + Intronic
1195325500 X:103754986-103755008 TACAGGCATGTGCTGATCCCAGG - Intergenic
1195329411 X:103785217-103785239 TACAGGCATACGCCCATGCCCGG + Intronic
1196524861 X:116719999-116720021 TACAGGCATGAGCCACCACGTGG + Intergenic
1197742712 X:129907679-129907701 TACAGGCATGAGCCATCACCCGG - Intronic
1198041926 X:132861066-132861088 TACAGGCATGAGCCACCACCTGG + Intronic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1200488759 Y:3797766-3797788 TACAGGCATGTTTCCACAAATGG + Intergenic
1200769824 Y:7113307-7113329 TACAGGCATCTGCCGGCACCCGG - Intergenic
1201390869 Y:13496120-13496142 TACAGGCATGCGCCACCACCTGG + Intergenic
1201504890 Y:14687322-14687344 AACAGGGATGTTCCCACCCCAGG - Intronic
1201912236 Y:19144559-19144581 TACAGGCATGTCACTACACCTGG - Intergenic