ID: 998283367

View in Genome Browser
Species Human (GRCh38)
Location 5:140834698-140834720
Sequence GCCTTTCCACGATCACCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 8, 2: 2, 3: 13, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998283367_998283369 -2 Left 998283367 5:140834698-140834720 CCTGGAGGTGATCGTGGAAAGGC 0: 1
1: 8
2: 2
3: 13
4: 102
Right 998283369 5:140834719-140834741 GCCGCTGCAGGTTTTCCATGTGG 0: 11
1: 1
2: 2
3: 12
4: 92
998283367_998283372 7 Left 998283367 5:140834698-140834720 CCTGGAGGTGATCGTGGAAAGGC 0: 1
1: 8
2: 2
3: 13
4: 102
Right 998283372 5:140834728-140834750 GGTTTTCCATGTGGACGTGGAGG 0: 6
1: 2
2: 2
3: 8
4: 134
998283367_998283374 13 Left 998283367 5:140834698-140834720 CCTGGAGGTGATCGTGGAAAGGC 0: 1
1: 8
2: 2
3: 13
4: 102
Right 998283374 5:140834734-140834756 CCATGTGGACGTGGAGGTGAAGG 0: 6
1: 3
2: 3
3: 30
4: 289
998283367_998283371 4 Left 998283367 5:140834698-140834720 CCTGGAGGTGATCGTGGAAAGGC 0: 1
1: 8
2: 2
3: 13
4: 102
Right 998283371 5:140834725-140834747 GCAGGTTTTCCATGTGGACGTGG 0: 7
1: 4
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998283367 Original CRISPR GCCTTTCCACGATCACCTCC AGG (reversed) Exonic
900013720 1:135636-135658 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
900043790 1:491619-491641 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
900065227 1:726622-726644 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
903917207 1:26773330-26773352 GCCTTTCTACGCTCAGCTCCAGG + Exonic
908924275 1:69234895-69234917 GCCTTCCTAGGATCACATCCTGG - Intergenic
911123736 1:94321074-94321096 GCCAGTCCACGAGCCCCTCCTGG + Intergenic
914777041 1:150746820-150746842 GCCTTGCCAGCCTCACCTCCTGG - Intronic
922779069 1:228237039-228237061 CCCTTTCCAGGATCCTCTCCAGG + Intronic
922910985 1:229217005-229217027 GCCTCTTCACTGTCACCTCCAGG - Intergenic
1063735848 10:8753366-8753388 GCCATTCCACTAACACGTCCAGG + Intergenic
1064429207 10:15256867-15256889 CCCTTTCCACGCTGCCCTCCAGG + Intronic
1069593365 10:69655366-69655388 GCCCTTCCTCCCTCACCTCCTGG - Intergenic
1072104022 10:92256876-92256898 GCCTTTCCTAGAAGACCTCCAGG + Intronic
1072634197 10:97166867-97166889 GCCTTCCCAAGGTCACCTGCTGG + Intronic
1074046563 10:109844798-109844820 GACTTTCCACAGTCTCCTCCTGG - Intergenic
1074288444 10:112120224-112120246 TCCTTTCCACGATGATCCCCAGG - Intergenic
1075667727 10:124243027-124243049 GCCTTTCCACAACCACTTGCAGG + Intergenic
1076813549 10:132902000-132902022 TCCTTTCCAGGATCTGCTCCCGG + Intronic
1076970064 11:127850-127872 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1080442772 11:32310758-32310780 GCCTTCCCAAGATGACCTACTGG - Intergenic
1081670708 11:44940926-44940948 GCCCTTCTACGAGCTCCTCCTGG + Intronic
1084201389 11:67560828-67560850 GCCTTTATATGATTACCTCCAGG - Intergenic
1085649663 11:78256368-78256390 TCCTTTCCACAATCACCCCTGGG - Intronic
1085649745 11:78257065-78257087 TCCTTTCCACAATCACCCCTGGG + Intronic
1088001084 11:104881268-104881290 GCCTTTCAAAGGTCACCTCTTGG - Intergenic
1089422982 11:118345655-118345677 GTCCTTCCACCATCAACTCCAGG - Intronic
1090644020 11:128752941-128752963 TGCTTTCCACGACCCCCTCCTGG - Intronic
1091902525 12:4155989-4156011 GCCTTTTCACGATCAGGTCAGGG + Intergenic
1096601090 12:52730137-52730159 GGCTCTCCACTTTCACCTCCAGG + Intergenic
1097043040 12:56167568-56167590 CCCTTTCCAAGTTCACCTCCTGG + Intronic
1104164463 12:126214565-126214587 GCCATGGCACGCTCACCTCCAGG + Intergenic
1112111695 13:96306917-96306939 GCCAATCCAGGATCAGCTCCAGG - Intronic
1114412728 14:22516040-22516062 GCCTTGGCAGGAGCACCTCCTGG - Intergenic
1114421826 14:22590054-22590076 GCCTTTCGACGCTGACATCCCGG - Intergenic
1118280125 14:64420684-64420706 GCCTTGCCACGTTCACCTTCTGG + Intronic
1120037049 14:79709649-79709671 GCCTCTCCACTTTCTCCTCCCGG + Intronic
1123059460 14:105587942-105587964 GCCTGTCCACCACCACCTCCTGG + Intergenic
1123083795 14:105708212-105708234 GCCTGTCCACCACCACCTCCTGG + Intergenic
1128887921 15:71305383-71305405 GTCTTCCCAAGATCACCCCCAGG + Intronic
1129608683 15:77037080-77037102 CCCCTTCCAGGATCACCTCCAGG - Exonic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1139410611 16:66756676-66756698 GGCTTTACATGATCAACTCCAGG - Intronic
1141906388 16:87029434-87029456 AGCTTCCCACAATCACCTCCTGG + Intergenic
1141913792 16:87078842-87078864 GCCTTTCCAGCAACACCTCCAGG - Intergenic
1142450613 16:90171282-90171304 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1142456949 17:62409-62431 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1146833319 17:36089094-36089116 GCCTTTCCAGGATAGCCTTCTGG + Intronic
1146847844 17:36195709-36195731 GCCTTTCCAGGATGGCCTTCTGG + Intronic
1156934129 18:42681742-42681764 GCTTTTCCACCATCACTTACAGG - Intergenic
1158783517 18:60680301-60680323 GCCATTGCACTATCACCTACTGG + Intergenic
1160480572 18:79236659-79236681 GCCTTTCGACAATCACTTCTGGG - Intronic
1160646862 19:197768-197790 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1161200573 19:3012554-3012576 GCCTCTCCACGAGCCCATCCCGG - Intronic
1165008815 19:32828308-32828330 GGCATTCAAAGATCACCTCCAGG - Intronic
1165641181 19:37388373-37388395 GCCTTTCCATTACCATCTCCTGG - Exonic
1165938348 19:39403058-39403080 GCCTGTCCTCGATCAGATCCAGG - Intergenic
924982223 2:234732-234754 GCCTTTCTACACTCTCCTCCTGG + Intronic
926681925 2:15670801-15670823 GCCTCTCTAAGTTCACCTCCTGG - Intergenic
931867715 2:66430486-66430508 GCCTTTCTCATATCACCTCCAGG + Intergenic
937658062 2:124399519-124399541 AGCTTTCCAGGATCACTTCCAGG - Intronic
939478548 2:142717942-142717964 GTATTTCTACGCTCACCTCCAGG - Intergenic
941284594 2:163593739-163593761 GCCTTTCCTCCATCAGCTTCTGG + Intronic
942222867 2:173788532-173788554 ACCCTGCCAGGATCACCTCCAGG + Intergenic
1168922589 20:1552816-1552838 GCCTTCCTACCATTACCTCCTGG - Intronic
1173896489 20:46554900-46554922 GCCTGTCCAGGTCCACCTCCCGG - Intergenic
1176267896 20:64220312-64220334 GCTTTTCCCCAATCAACTCCTGG - Intronic
1179112589 21:38460238-38460260 GCCTTTCCTGGTTCACCTCCTGG - Intronic
1180501763 22:15936139-15936161 ACCTTTCCACTATGAGCTCCTGG - Intergenic
1182119806 22:27779348-27779370 GCCTTGCCCCAATCACATCCCGG + Intronic
1184168668 22:42745582-42745604 GCCTCTCCTCGCTCAACTCCTGG - Intergenic
1184265159 22:43342764-43342786 CCCTTTCCCCGTCCACCTCCTGG + Intronic
1184409971 22:44320738-44320760 GCCCTTCCTCCATCACCTGCAGG - Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
950098980 3:10345860-10345882 GCCTTTCCAGGAAGACCTCGGGG + Intronic
950722912 3:14897637-14897659 GCCTTTCCTCCAGCTCCTCCAGG - Exonic
953460926 3:43080706-43080728 GCCTCTCCAAGATCACTACCTGG - Exonic
954401326 3:50321286-50321308 GCCTCTCCGCGAGCACCCCCGGG + Exonic
957891289 3:86362526-86362548 GCCTCTCCACCATCACCCCCAGG + Intergenic
959420943 3:106127604-106127626 GCCTTTCCACCTTTTCCTCCAGG + Intergenic
964295737 3:155231094-155231116 GCATTACCACCAGCACCTCCAGG - Intergenic
967171143 3:186824687-186824709 GCCTTTCCACGCTTCCCTGCAGG + Intergenic
968039110 3:195573647-195573669 GCATTTCCATGACCACCTGCGGG - Intronic
968370819 3:198221754-198221776 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
969256933 4:6008508-6008530 GCCTGGCCACGCTCTCCTCCCGG + Intergenic
970481426 4:16479700-16479722 GCCTTCCCAGAATTACCTCCTGG - Intergenic
970511401 4:16785316-16785338 GCCTTTTCTCAATCACTTCCTGG + Intronic
971189746 4:24416119-24416141 GCCTTTCTTGGATCACTTCCTGG - Intergenic
985604344 5:850429-850451 GCCTTTCCTCGGCCACCTTCGGG - Exonic
997421044 5:133766981-133767003 GCCTTTCCTTGACCATCTCCTGG - Intergenic
998278967 5:140786605-140786627 GCCTGTCGGCGATCAACTCCAGG - Exonic
998280387 5:140801512-140801534 GCCTGTCCACGATCACCTCCAGG - Exonic
998280998 5:140807502-140807524 GCCTGTCTACGATCACCTCCAGG - Exonic
998282154 5:140822087-140822109 GCCTGTCCACGATCACCTCCAGG - Exonic
998282773 5:140828406-140828428 GCCTGTCCACGATCACCTCCAGG - Exonic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
998284078 5:140841636-140841658 GCCTGTCCACGATCACCTCCAGG - Exonic
998284733 5:140848810-140848832 GCCTGTCTACGATCACCTCCAGG - Exonic
998285465 5:140856360-140856382 GCCTGTCCACGATCACCTCCAGG - Exonic
998286005 5:140861542-140861564 GCTTGTCCACGATCACTTCCAGG - Intronic
998286677 5:140869418-140869440 GCCTGTCCACGATCACCTCCAGG - Exonic
998287316 5:140875787-140875809 GCCTGTCCACGATCACCTCCAGG - Exonic
998287977 5:140882583-140882605 GCCTGTCCACGATCACCTCCAGG - Exonic
1000604101 5:163309963-163309985 GGCTTTCCACTGTCACCTCAAGG + Intergenic
1001068110 5:168556339-168556361 GCATTTCTACCATCAACTCCTGG + Exonic
1002294742 5:178224083-178224105 GCCTCTCCAGGATCAGCTCCTGG + Intronic
1002730053 5:181327310-181327332 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1006893067 6:37446413-37446435 GCCAGTCCACGTTCAGCTCCTGG - Exonic
1008946405 6:57101653-57101675 GCTTTTCCACGATCAAATTCTGG - Intronic
1015689579 6:135906854-135906876 ACCTTTCCACAATGACATCCTGG - Intronic
1017118823 6:151004553-151004575 GCCTTTCCATGATCATCCACGGG - Intronic
1019059735 6:169248473-169248495 GCCCTTCTACGAGCACCTGCAGG - Exonic
1022478041 7:30724595-30724617 CCCTGTCCAGGATCCCCTCCAGG + Intronic
1023000362 7:35801614-35801636 GCCTTTCCTCAGTCTCCTCCCGG + Intronic
1025855105 7:65269602-65269624 GCCTCCCCACGGTCAGCTCCCGG + Intergenic
1035137019 7:156713600-156713622 CCCTATCCACCATCAGCTCCAGG - Intronic
1039714281 8:40091346-40091368 ACCTTTCCAGGATCCCATCCAGG + Intergenic
1042243579 8:66689072-66689094 GCATTGCCACTATGACCTCCAGG + Intronic
1049687583 8:143945077-143945099 GCCTTTCCAAGAGCACCCCCTGG - Intronic
1050781045 9:9336453-9336475 GCCTGTCCACCATCATCACCTGG - Intronic
1051414452 9:16824475-16824497 GCCTGTCCTCAGTCACCTCCTGG + Intronic
1057203372 9:93155850-93155872 ACCCTTCCCCCATCACCTCCCGG - Intergenic
1061787931 9:133041983-133042005 GCCTTTCCTGGATCACCGTCAGG + Intronic
1062754468 9:138279824-138279846 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1203578372 Un_KI270745v1:23984-24006 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1186425896 X:9464649-9464671 GCCTTTCCACGACTGCCTCGAGG - Intronic
1186771762 X:12825341-12825363 TGCTTTCCAAGATCACATCCTGG + Intergenic